Busch Lab

ZMP

si:ch73-235d11.1

Ensembl ID:
ENSDARG00000061462
ZFIN ID:
ZDB-GENE-060503-234
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1L860]
Human Orthologue:
C6orf27
Human Description:
chromosome 6 open reading frame 27 [Source:HGNC Symbol;Acc:13939]
Mouse Orthologue:
D17H6S56E-3
Mouse Description:
DNA segment, Chr 17, human D6S56E 3 Gene [Source:MGI Symbol;Acc:MGI:1306798]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14571 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4766
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087664 Splice Site, Nonsense 590 1010 11 16
ENSDART00000132833 None None 497 None 10
Genomic Location (Zv9):
Chromosome 18 (position 38840981)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40553698
GRCz11 18 40543890
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TRTATGGCAGCTTACAGTCAAAGCCATTGGACCAATTACATTTAATGCCT[T/A]AGGTAAAGATTCTGAGAGAAAATCCCAGTCTTATCWTATTTTGTATTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14571
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087664 Nonsense 980 1010 16 16
ENSDART00000132833 None None 497 None 10
Genomic Location (Zv9):
Chromosome 18 (position 38845586)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40558303
GRCz11 18 40548495
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGTAATATGAGACGCTGTCATCTCAAAGCTAGTCAGCAGAGGGCACTA[C/T]GAGAAAACAACAGKGCACACAGTGGGGAATCTACCTCWTGKTTACCAATG
Associated Phenotype:
Not determined