Busch Lab

ZMP

nrxn2a

Ensembl ID:
ENSDARG00000061454
ZFIN ID:
ZDB-GENE-070206-5
Description:
neurexin 2a [Source:RefSeq peptide;Acc:NP_001073439]
Human Orthologue:
NRXN2
Human Description:
neurexin 2 [Source:HGNC Symbol;Acc:8009]
Mouse Orthologue:
Nrxn2
Mouse Description:
neurexin II Gene [Source:MGI Symbol;Acc:MGI:1096362]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa32351 Nonsense Available for shipment Available now
sa45740 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16817 Essential Splice Site Available for shipment Available now
sa18390 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32351
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087657 Nonsense 455 1670 9 24
ENSDART00000087660 None None 642 None 7
ENSDART00000132583 None None 648 None 7
ENSDART00000141629 Nonsense 455 1670 10 24

The following transcripts of ENSDARG00000061454 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 27473300)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28042211
GRCz11 21 28078906
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTCTCTCCCTGTCCCAGGTGGTCTACACCAATAATGAGTTCAGACTA[G/T]AGCTCTCCCATCTGGCGGAATTGCGTGACCCTAAGGTTACCCTCCATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45740
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087657 Essential Splice Site 783 1670 11 24
ENSDART00000087660 None None 642 None 7
ENSDART00000132583 None None 648 None 7
ENSDART00000141629 Essential Splice Site 783 1670 12 24

The following transcripts of ENSDARG00000061454 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 27469106)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28038017
GRCz11 21 28074712
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCGCCTGGAGCTGGACGGGGGAAGAGTCAAGCTTACCGTCAACCTCGG[T/C]AAAACCACCAGACTCGAGGCTCTTCCCAAAACACATTTCACTCTCATTCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5683
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087657 Essential Splice Site 792 1670 13 24
ENSDART00000087660 None None 642 None 7
ENSDART00000132583 None None 648 None 7
ENSDART00000141629 None None 1670 None 24

The following transcripts of ENSDARG00000061454 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 27452574)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28021485
GRCz11 21 28058180
KASP Assay ID:
554-3574.1 (used for ordering genotyping assays)
KASP Sequence:
AAAATATCTGACTACAAACTTTGTAAAAAGTAACAAACACATTTTCTTCA[A/G]ATAGCACAATTAATTTTAACATCAATGATAGATCACGTGAAACTGAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16817
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087657 Essential Splice Site 962 1670 15 24
ENSDART00000087660 None None 642 None 7
ENSDART00000132583 None None 648 None 7
ENSDART00000141629 Essential Splice Site 962 1670 15 24

The following transcripts of ENSDARG00000061454 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 27445497)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28014408
GRCz11 21 28051103
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAACTCTGGGGATGGCAGTGACTTTATCGTGATYGAGCTTGTAAAAGGG[T/A]AAGTGTGAGTTTTAATTGAACAATTTTAACAAATAATACAGGGTTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18390
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087657 Nonsense 1080 1670 17 24
ENSDART00000087660 None None 642 None 7
ENSDART00000132583 None None 648 None 7
ENSDART00000141629 Nonsense 1080 1670 17 24

The following transcripts of ENSDARG00000061454 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 27407096)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27976007
GRCz11 21 28012702
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACTTTCAGACCTGATTGCAGATGCTCTGCACCGTGTKGGCCAAGTGGAG[C/T]GAGGATGTGAGGGTCAGTATACTGATGCTCTGAGGCAATCATGACAACAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7962
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087657 Essential Splice Site 1084 1670 18 24
ENSDART00000087660 None None 642 None 7
ENSDART00000132583 None None 648 None 7
ENSDART00000141629 Essential Splice Site 1084 1670 18 24

The following transcripts of ENSDARG00000061454 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 27403380)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27972291
GRCz11 21 28008986
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATAATTGCATATATTATATTTCTGCTTTTCCAACTTGCTGTTTGTTTC[A/G]GCCGGTCCCGGCACAACCTGCACGGAAGACTCATGCTCCAATCAGGGCGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29614
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087657 Essential Splice Site 1272 1670 21 24
ENSDART00000087660 Essential Splice Site 244 642 4 7
ENSDART00000132583 Essential Splice Site 250 648 4 7
ENSDART00000141629 Essential Splice Site 1272 1670 21 24

The following transcripts of ENSDARG00000061454 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 27056598)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27625509
GRCz11 21 27662204
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTCCATACAGACTTGGTCGGGTAGTTGACGAGTGGCTACTCGACAAAG[G/A]TAATAAAATGAATTAATTAAACAATGACTTAATGATTTATTAAGGCTCTG
Associated Phenotype:
Not determined