Busch Lab

ZMP

zgc:162595

Ensembl ID:
ENSDARG00000061416
ZFIN ID:
ZDB-GENE-030131-5712
Description:
hypothetical protein LOC569005 [Source:RefSeq peptide;Acc:NP_001082891]
Human Orthologues:
C2CD4A, C2CD4B
Human Descriptions:
C2 calcium-dependent domain containing 4A [Source:HGNC Symbol;Acc:33627]
C2 calcium-dependent domain containing 4B [Source:HGNC Symbol;Acc:33628]
Mouse Orthologues:
C2cd4a, CT573422.1
Mouse Descriptions:
C2 calcium-dependent domain containing 4A Gene [Source:MGI Symbol;Acc:MGI:3645763]
family with sequence similarity 148, member B [Source:RefSeq peptide;Acc:NP_001074783]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30297
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087586 Nonsense 36 457 2 2
Genomic Location (Zv9):
Chromosome 25 (position 34254965)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32402110
GRCz11 25 32887537
KASP Assay ID:
554-5510.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTACGGAATACAGCTTCAAACTCGGAGACATCATGTTCGGAGACAAGT[C/A]GTCCATTGACAAAGCCAAAAAAGTCTTGCTGTGTCCGAACATCATTACCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4300
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087586 Nonsense 251 457 2 2
Genomic Location (Zv9):
Chromosome 25 (position 34255609)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32401466
GRCz11 25 32886893
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATACYACTTCCTCGGCAGAGTCGTCTCCTTTTAGTTCACCYCTGCTGAAC[A/T]GATGCCCWCAGAAATCTTCTCTCCTCAAAGCACTTAATCATGAAAACCTA
Associated Phenotype:
Not determined