Busch Lab

ZMP

sec23ip

Ensembl ID:
ENSDARG00000061413
ZFIN ID:
ZDB-GENE-030131-5259
Description:
SEC23-interacting protein [Source:RefSeq peptide;Acc:NP_001070847]
Human Orthologue:
SEC23IP
Human Description:
SEC23 interacting protein [Source:HGNC Symbol;Acc:17018]
Mouse Orthologue:
Sec23ip
Mouse Description:
Sec23 interacting protein Gene [Source:MGI Symbol;Acc:MGI:2450915]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa15118 Essential Splice Site Available for shipment Available now
sa13215 Essential Splice Site Available for shipment Available now
sa42209 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22306 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15118
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087553 Essential Splice Site 45 977 2 18
Genomic Location (Zv9):
Chromosome 13 (position 25775602)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25421262
GRCz11 13 25551712
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCATGTATTGATATTAAAAATGATGCTAGATTTTTGTTTTTCTCTGTGC[A/T]GAAGATGCCRGTGAAGTYGGAGAAGAAGACAGCTTTCTTGGTCWGACAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2736
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087553 Nonsense 351 977 5 18
Genomic Location (Zv9):
Chromosome 13 (position 25778392)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25424052
GRCz11 13 25554502
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGACGTCATTTAATTTTTCAATGTTGTGTGTGTTGTAAACAGGCGGAATA[T/G]AAGAAAGCAGTCACTACTAATCAGTGGCACCGCAGACTGGAGTTTCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13215
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087553 Essential Splice Site 378 977 5 18
Genomic Location (Zv9):
Chromosome 13 (position 25778475)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25424135
GRCz11 13 25554585
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGACTGGAGTTYCCATCKGGTGAGACCATCGTGATGCACAATCCAAAGG[T/C]ACAACACTATCAGATTGATGGKAAACTATGGAAGCTTAGTTCASTCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42209
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087553 Essential Splice Site 449 977 7 18
Genomic Location (Zv9):
Chromosome 13 (position 25779412)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25425072
GRCz11 13 25555522
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCATTGGTCCTGTCTGTGATCTGCGGTTTAGGAGTATGGTGGAGTGCGG[T/C]ATGTTACACTAAGTTACTCTCCAGATCAAATACAGTTTTTAAGACATTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2727
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087553 Nonsense 692 977 13 18
ENSDART00000087553 Nonsense 692 977 13 18
Genomic Location (Zv9):
Chromosome 13 (position 25784492)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25430152
GRCz11 13 25560602
KASP Assay ID:
2260-6448.1 (used for ordering genotyping assays)
KASP Sequence:
AGCTTTTCTATTTGTCAAGTTTCATGTGACGNNTGTTTTTCGACAGGCTGCT[C/T]GAAAGGCTTTGAAAGAGAAGTCTGTAGAAAAAGAGGAACTGAAGCAGACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19061
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087553 Nonsense 692 977 13 18
ENSDART00000087553 Nonsense 692 977 13 18
Genomic Location (Zv9):
Chromosome 13 (position 25784492)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25430152
GRCz11 13 25560602
KASP Assay ID:
2260-6448.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTTTTCTATTTGTCAAGTTTCATGTGACGTGTTTTTCGACAGGCTGCT[C/T]GAAAGGCTTTGAAAGAGAAGTCTGTAGAAAAAGAGGAACTGAAGCAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22306
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087553 Essential Splice Site 834 977 15 18
Genomic Location (Zv9):
Chromosome 13 (position 25787397)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25433057
GRCz11 13 25563507
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCCGGTTTTGGTCCCTCATCATAAAGGGAGGAAAAGGCTTCATCTCGG[T/G]AATGTATTAGACCATTTCTGTGCATTTTTTGAATGATCTTTCTCATTTAT
Associated Phenotype:
Not determined