Busch Lab

ZMP

bcl11a

Ensembl ID:
ENSDARG00000061352
ZFIN ID:
ZDB-GENE-060421-4643
Description:
B-cell lymphoma/leukemia 11A [Source:RefSeq peptide;Acc:NP_001035481]
Human Orthologue:
BCL11A
Human Description:
B-cell CLL/lymphoma 11A (zinc finger protein) [Source:HGNC Symbol;Acc:13221]
Mouse Orthologue:
Bcl11a
Mouse Description:
B-cell CLL/lymphoma 11A (zinc finger protein) Gene [Source:MGI Symbol;Acc:MGI:106190]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa18 Essential Splice Site Confirmed mutation in F2 line Not yet available
sa22311 Nonsense Available for shipment Available now
sa38944 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087426 Essential Splice Site 19 829 2 3
ENSDART00000132521 Essential Splice Site None 68 2 2
Genomic Location (Zv9):
Chromosome 13 (position 26080506)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25726166
GRCz11 13 25856616
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTGCTTTTCATTCCCTCTGTGTCGCATATGGATTCTTCCTGCGTGCA[G/A]CCGAGCCCCTGTCAGCCGTGGTCTCGGAGGAGAGGCAGGAACAGCGCGGG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa22311
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087426 Nonsense 371 829 3 3
ENSDART00000132521 None None 68 None 2
Genomic Location (Zv9):
Chromosome 13 (position 26147395)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25793055
GRCz11 13 25923505
KASP Assay ID:
2260-6466.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACCAAGTCTTGTGAATTCTGTGGGAAGACCTTCAAGTTCCAGAGTAATT[T/A]AATAGTGCATCGACGCAGTCACACGGGTGAGAAACCATACAAGTGCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38944
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087426 Nonsense 676 829 3 3
ENSDART00000132521 None None 68 None 2
Genomic Location (Zv9):
Chromosome 13 (position 26148309)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25793969
GRCz11 13 25924419
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCTGCTTCTAGGCAGCTCAAGGACCCCTTTCTGAATTTTGGGGATTCC[A/T]GACAATCGCCTTTCGCCTCATCTTCAGAGCACTCCTCAGAGAATGGAAGC
Associated Phenotype:
Not determined