Busch Lab

ZMP

wwp2

Ensembl ID:
ENSDARG00000061345
ZFIN ID:
ZDB-GENE-000607-82
Description:
NEDD4-like E3 ubiquitin-protein ligase WWP2 [Source:RefSeq peptide;Acc:NP_001092918]
Human Orthologue:
WWP2
Human Description:
WW domain containing E3 ubiquitin protein ligase 2 [Source:HGNC Symbol;Acc:16804]
Mouse Orthologue:
Wwp2
Mouse Description:
WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa44346 Nonsense Mutation detected in F1 DNA Not yet available
sa19371 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30301
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087364 Essential Splice Site 330 866 9 23
ENSDART00000136640 Essential Splice Site 330 866 11 25
ENSDART00000139582 None None 46 None 4
ENSDART00000141473 None None 276 None 8

The following transcripts of ENSDARG00000061345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 35829309)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34260641
GRCz11 25 34765599
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTCTGCAGATTCCCTCTGTCCCTGCTCATGATCTGTGTTTGTGTTGTA[G/A]TTGGGAGAAGCGTGTGGATCAGCGCGGCCGGTTCTACTATGTGGACCACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8066
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087364 Nonsense 552 866 15 23
ENSDART00000136640 Nonsense 552 866 17 25
ENSDART00000139582 None None 46 None 4
ENSDART00000141473 None None 276 None 8

The following transcripts of ENSDARG00000061345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 35854928)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34286260
GRCz11 25 34791218
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCCGCCGGCGACTCTACATAATCATGAGAGGRGAGGAAGGCCTGGATTA[C/A]GGAGGAATCGCCAGGCAAGTCAAACCCTGTAKCRTCCYGTTGTCCGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44346
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087364 Nonsense 627 866 17 23
ENSDART00000136640 Nonsense 627 866 19 25
ENSDART00000139582 None None 46 None 4
ENSDART00000141473 None None 276 None 8

The following transcripts of ENSDARG00000061345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 35860687)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34292019
GRCz11 25 34796977
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGTTGTATCATGGGAAGTTCATTGACACAGGCTTCACTTTGCCATTCTA[C/A]AAGCGGATGCTGAACAAGAAGCCCACGCTGAAAGACCTGGAGTCCATCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19371
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087364 Essential Splice Site 834 866 22 23
ENSDART00000136640 Essential Splice Site 834 866 24 25
ENSDART00000139582 None None 46 None 4
ENSDART00000141473 None None 276 None 8

The following transcripts of ENSDARG00000061345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 35865140)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34296472
GRCz11 25 34801430
KASP Assay ID:
2261-7175.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATAGACAAAGTGGGGAAGGAAACATGGCTGCCTAGAAGTCACACTTGG[T/G]GAGGCTCAAAAAAACAAAAAACAACAACAACTATTAAAACATGCCTTCAT
Associated Phenotype:
Not determined