Busch Lab

ZMP

si:dkey-101k6.3

Ensembl ID:
ENSDARG00000061265
ZFIN ID:
ZDB-GENE-081104-298
Description:
Novel protein similar to human and mouse leishmanolysin-like (Metallopeptidase M8 family) (LMLN) [So
Human Orthologue:
LMLN
Human Description:
leishmanolysin-like (metallopeptidase M8 family) [Source:HGNC Symbol;Acc:15991]
Mouse Orthologue:
Lmln
Mouse Description:
leishmanolysin-like (metallopeptidase M8 family) Gene [Source:MGI Symbol;Acc:MGI:2444736]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa10369 Nonsense Available for shipment Available now
sa34710 Nonsense Mutation detected in F1 DNA Not yet available
sa31738 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10369
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087229 Nonsense 52 664 2 17
ENSDART00000140331 Nonsense 8 619 1 16
Genomic Location (Zv9):
Chromosome 9 (position 39555563)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38693459
GRCz11 9 38503254
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGATAGCAATATCTGCTGTTACTCTTTTAGGTGATTCATAAGGTCTTTT[T/A]GAAGCCAGATAGACTGACCAAAAGAAGCACTGACCAGCAGTTAAACATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34710
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087229 Nonsense 108 664 4 17
ENSDART00000140331 Nonsense 64 619 3 16
Genomic Location (Zv9):
Chromosome 9 (position 39555945)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38693841
GRCz11 9 38503636
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTCCCACAGGCTATTGATTATCTTCAGAAGGCTTTCAGGGTTCGCAGA[C/T]AGTCGGGTCCGATATTACTTAGCAGGTAATTCTCTTCTGAGCGACTATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31738
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087229 Nonsense 285 664 9 17
ENSDART00000140331 Nonsense 241 619 8 16
Genomic Location (Zv9):
Chromosome 9 (position 39560017)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38697913
GRCz11 9 38507708
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTTCTATCATTTAATTCATTACTTTCTGTCTTTCTCTCAGTTTAGGGT[T/A]ATATCAGTGGAGTGATAAAGTCATTAAAAGAGCAACTCGACTGTGGGACA
Associated Phenotype:
Not determined