Busch Lab

ZMP

zgc:153766

Ensembl ID:
ENSDARG00000061211
ZFIN ID:
ZDB-GENE-060825-146
Description:
hypothetical protein LOC751741 [Source:RefSeq peptide;Acc:NP_001038916]
Human Orthologue:
SPG20
Human Description:
spastic paraplegia 20 (Troyer syndrome) [Source:HGNC Symbol;Acc:18514]
Mouse Orthologue:
Spg20
Mouse Description:
spastic paraplegia 20, spartin (Troyer syndrome) homolog (human) Gene [Source:MGI Symbol;Acc:MGI:213

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa35950 Nonsense Mutation detected in F1 DNA Not yet available
sa35949 Nonsense Mutation detected in F1 DNA Not yet available
sa5792 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa35950
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087053 Nonsense 3 273 2 2
ENSDART00000126008 Nonsense 3 600 1 8
Genomic Location (Zv9):
Chromosome 15 (position 33074261)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32942290
GRCz11 15 32800269
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATATTAAAACACTTTGACTGCCTTCTTACTTGTCTTTTCAGTCATGGAG[C/T]AAGCAAAGCAAGATCGATTTGATCACGCCAGGCTGCAGGTGATCAAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35949
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087053 Nonsense 174 273 2 2
ENSDART00000126008 Nonsense 174 600 1 8
Genomic Location (Zv9):
Chromosome 15 (position 33073746)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32942805
GRCz11 15 32800784
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCCTGCATACACCCCTCAAGCTGCTGACGGACACCTGACCATTTCCTA[T/A]GGCACAGATTCAGGCGAACTCTCTGTGGTTGGCGATGAGTTTTACAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5792
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087053 Nonsense 270 273 2 2
ENSDART00000126008 None None 600 None 8
Genomic Location (Zv9):
Chromosome 15 (position 33073460)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32943091
GRCz11 15 32801070
KASP Assay ID:
554-3516.1 (used for ordering genotyping assays)
KASP Sequence:
CACCTGCCTTTCTCCAGGTAAGAATTTACAAAAASAGTCCCTGTTTGGAT[C/T]AATGGAAAAAANTAAATCSACAAGCTAATKTATTGACATTTAAGATTACTA
Associated Phenotype:
Not determined