Busch Lab

ZMP

emilin2a

Ensembl ID:
ENSDARG00000061196
ZFIN ID:
ZDB-GENE-060503-247
Human Orthologue:
EMILIN2
Human Description:
elastin microfibril interfacer 2 [Source:HGNC Symbol;Acc:19881]
Mouse Orthologue:
Emilin2
Mouse Description:
elastin microfibril interfacer 2 Gene [Source:MGI Symbol;Acc:MGI:2389136]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa32947 Nonsense Mutation detected in F1 DNA Not yet available
sa719 Essential Splice Site Available for shipment Available now
sa718 Essential Splice Site Available for shipment Available now
sa9754 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32947
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087026 Nonsense 41 1024 1 8
ENSDART00000140841 Nonsense 75 776 2 4
ENSDART00000148157 None None 155 None 2
Genomic Location (Zv9):
Chromosome 2 (position 30732152)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31033787
GRCz11 2 31017320
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGAACCTGAAGCCGCGCGCTGTCCTGAGCACCAGCCTGACTGTGAGCCA[C/T]AAATGATGTAAGTCCTCGAGAGACCGGGAGGGGCGTGTGGTGGAAACACG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3382
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087026 Essential Splice Site 43 1024 None 8
ENSDART00000140841 Essential Splice Site 77 776 None 4
ENSDART00000148157 None None 155 None 2
Genomic Location (Zv9):
Chromosome 2 (position 30728532)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31030167
GRCz11 2 31013700
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGGATTTTCACAGCATGTAAAATCATCATAATCAMTGTTTTTTTTTTC[A/G]GATACCGTACTCGATTTCGTCCAACTTATAAGATAGCATACAAGACCGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8086
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087026 Nonsense 102 1024 2 8
ENSDART00000140841 Nonsense 136 776 3 4
ENSDART00000148157 None None 155 None 2
Genomic Location (Zv9):
Chromosome 2 (position 30728355)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31029990
GRCz11 2 31013523
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATAGCGAATCCACAATCATACCCACAATATCCACAGCATGGACAAACT[C/T]GAACTGCACAAAGTATGGAATCTTTCACAATGATTGCATGTTRTTTCTRT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa719
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087026 Essential Splice Site 117 1024 2 8
ENSDART00000140841 None None 776 None 4
ENSDART00000148157 None None 155 None 2
Genomic Location (Zv9):
Chromosome 2 (position 30728306)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31029941
GRCz11 2 31013474
KASP Assay ID:
554-0627.1 (used for ordering genotyping assays)
KASP Sequence:
TCGAACTGCACAAAGTATGGAATCTTTCACAATGATTGCATGTTRTTTCT[G/A]TATGTTCTAATGCATGTATTCATTTTTTAGGTTTAAATGATCTTAATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa718
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087026 Essential Splice Site 118 1024 3 8
ENSDART00000140841 None None 776 None 4
ENSDART00000148157 None None 155 None 2
Genomic Location (Zv9):
Chromosome 2 (position 30728241)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31029876
GRCz11 2 31013409
KASP Assay ID:
554-0626.1 (used for ordering genotyping assays)
KASP Sequence:
TGTATTCATTTTTTAGGTTTAAATGATCTTAATGGTGATTTGTTTCTATA[C/T]GTTTCGTTACCACAGGACCAGAGCGGCGGGAAACTGTACAATATGACTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25836
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087026 Nonsense 128 1024 3 8
ENSDART00000140841 Nonsense 145 776 4 4
ENSDART00000148157 None None 155 None 2
Genomic Location (Zv9):
Chromosome 2 (position 30728211)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31029846
GRCz11 2 31013379
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGGTGATTTGTTTCTATACGTTTCGTTACCACAGGACCAGAGCGGCGG[G/T]AAACTGTACAATATGACTTGAGAAGAGGAGCTGACAGAACACGAATGTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25835
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087026 Nonsense 525 1024 3 8
ENSDART00000140841 Nonsense 542 776 4 4
ENSDART00000148157 None None 155 None 2
Genomic Location (Zv9):
Chromosome 2 (position 30727020)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31028655
GRCz11 2 31012188
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAGTTTAGTACACTTGGGCAAAATTGTTCTACCAACTGCAAAAGCAAC[C/T]AACCCTCTGATTCCAAAAAGCCTGAAGGTCTAGAAAGTGTTGTGAAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9754
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087026 Nonsense 993 1024 8 8
ENSDART00000140841 None None 776 None 4
ENSDART00000148157 Nonsense 124 155 2 2
Genomic Location (Zv9):
Chromosome 2 (position 30701925)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31003560
GRCz11 2 30987093
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCGTCTTTCAGCCTCATYCTYCCKCTCCACAGAGGTGACACCRTGGCCT[T/A]GGTCCGCACTGCTGGTAAGCTGGCGGTCTCYGAATCAAGAGAGATCCTCT
Associated Phenotype:
Not determined