Busch Lab

ZMP

cnnm2a

Ensembl ID:
ENSDARG00000061195
ZFIN ID:
ZDB-GENE-050208-36
Description:
cyclin M2a [Source:RefSeq peptide;Acc:NP_001138257]
Human Orthologue:
CNNM2
Human Description:
cyclin M2 [Source:HGNC Symbol;Acc:103]
Mouse Orthologue:
Cnnm2
Mouse Description:
cyclin M2 Gene [Source:MGI Symbol;Acc:MGI:2151054]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa14149 Nonsense Available for shipment Available now
sa22317 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa587
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087001 Nonsense 156 811 1 8
Genomic Location (Zv9):
Chromosome 13 (position 28842236)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28488184
GRCz11 13 28618634
KASP Assay ID:
554-0497.1 (used for ordering genotyping assays)
KASP Sequence:
ATCGAGCTCGAGGTGAAGCCTCTGCGCAAAACGGAAAAAAGYAAAACGTA[T/G]TACCTGTGCACCGCCATCGGGACACCTGGCGCGCAGGACTCCTGGTCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14149
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087001 Nonsense 672 811 6 8
Genomic Location (Zv9):
Chromosome 13 (position 28859743)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28505691
GRCz11 13 28636141
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTCTCTCTTTTTTCCGTCCTCTTGCTSTCCAGTTCCTCTCTCCTTGTCT[C/T]GAACCTTCGTGGTCAGCAGGGCAGAATCACTGGCAGRATCTCCAGGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22317
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087001 Nonsense 751 811 8 8
Genomic Location (Zv9):
Chromosome 13 (position 28866377)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28512325
GRCz11 13 28642775
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAAACGGCTGATTGATTCTAAATCTCCATTTTTCAGGTGACCCGCCAG[C/T]AATACCAGAATGCCCTGATGGCATCTCGCATGGACAAAACACCTCAATCC
Associated Phenotype:
Not determined