Busch Lab

ZMP

LOC100331333

Ensembl ID:
ENSDARG00000061186
Human Orthologue:
ITGA4
Human Description:
integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor) [Source:HGNC Symbol;Acc:6140]
Mouse Orthologue:
Itga4
Mouse Description:
integrin alpha 4 Gene [Source:MGI Symbol;Acc:MGI:96603]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa34752 Nonsense Mutation detected in F1 DNA Not yet available
sa34753 Nonsense Available for shipment Available now
sa14884 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34752
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086963 Nonsense 296 739 9 20
Genomic Location (Zv9):
Chromosome 9 (position 45121204)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44246339
GRCz11 9 44048126
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCGGACACAATAGTCATGTTTGTTCCTGTTTACAGCTTGGCTCTTATTA[T/A]GGGGCGAGTGTTTGTGCTGTCGACCTGAACGCAGATGGACTGTCTGATCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27475
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086963 Nonsense 330 739 9 20
Genomic Location (Zv9):
Chromosome 9 (position 45121306)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44246441
GRCz11 9 44048228
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGTTGGAGCGCCAATGTTCAGCTCAGTGCGGGAAGAGGGACGCGTGTA[T/A]GTTTACATCAACCAGGGAGAGGTGAGGCAGTGTTCATTGCTTTGATGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34753
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086963 Nonsense 358 739 10 20
Genomic Location (Zv9):
Chromosome 9 (position 45123239)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44248374
GRCz11 9 44050161
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGGCTGACTTTGAGTTAGTCGGCAGTGACTCTTATGCCGCACGATTT[G/T]GAGAAACCATCATAAACCTCGGTGATATTGATGATGATGGATATCCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14884
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086963 Nonsense 468 739 14 20
Genomic Location (Zv9):
Chromosome 9 (position 45134544)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44259679
GRCz11 9 44061466
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACTCGTCCAGTGGTGAAGGTGGATGCTGTYATGTTGTTGCCTGAGAGCT[T/A]GAATCGKTCTGTAGCCCAGTGCACTGAAAAYGGCCAGCCTGCTGTCTGCA
Associated Phenotype:
Not determined