Busch Lab

ZMP

st14a

Ensembl ID:
ENSDARG00000061173
ZFIN ID:
ZDB-GENE-030131-6496
Description:
matriptase [Source:RefSeq peptide;Acc:NP_001035441]
Human Orthologue:
ST14
Human Description:
suppression of tumorigenicity 14 (colon carcinoma) [Source:HGNC Symbol;Acc:11344]
Mouse Orthologue:
St14
Mouse Description:
suppression of tumorigenicity 14 (colon carcinoma) Gene [Source:MGI Symbol;Acc:MGI:1338881]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa39215 Nonsense Mutation detected in F1 DNA Not yet available
sa23372 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29088
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086952 Essential Splice Site 473 834 13 20
ENSDART00000098558 Essential Splice Site 466 827 13 20
ENSDART00000121994 None None 233 None 7
ENSDART00000135386 None None 191 None 6
ENSDART00000140672 None None 77 None 3
Genomic Location (Zv9):
Chromosome 18 (position 42972882)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44562773
GRCz11 18 44556227
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGACGGCTGGAACGACTGCGGTGACACCAGCGACGAGCAGAACTGCCG[T/A]AAGTTGTTCAGTGAACCTGGTCTTCAACCACACACAATTGCACACTTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39215
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086952 Nonsense 514 834 15 20
ENSDART00000098558 Nonsense 507 827 15 20
ENSDART00000121994 None None 233 None 7
ENSDART00000135386 None None 191 None 6
ENSDART00000140672 None None 77 None 3
Genomic Location (Zv9):
Chromosome 18 (position 42974128)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44564019
GRCz11 18 44557473
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCTTGTTTGACATAGTTGTTCTCTTTTCTGGCAGGATGTAGAGCTGAT[C/T]AATTTAAGTGCAAGAACGATAAATGCATCTCAGAGAAGCAGAAGTGTGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6533
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086952 Nonsense 550 834 16 20
ENSDART00000098558 Nonsense 543 827 16 20
ENSDART00000121994 None None 233 None 7
ENSDART00000135386 None None 191 None 6
ENSDART00000140672 None None 77 None 3
Genomic Location (Zv9):
Chromosome 18 (position 42974779)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44564670
GRCz11 18 44558124
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGTTRTCTTCTATTTACCACTGATGGYCTTTCTTTCCTRCAGATTCATG[T/A]TTAGTCTCAACATTTYTMTGCGGAAATAGCAAATGCATCACCAAACCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23372
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086952 Essential Splice Site 737 834 18 20
ENSDART00000098558 Essential Splice Site 730 827 18 20
ENSDART00000121994 Essential Splice Site 136 233 5 7
ENSDART00000135386 None None 191 None 6
ENSDART00000140672 None None 77 None 3
Genomic Location (Zv9):
Chromosome 18 (position 42977096)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44566987
GRCz11 18 44560441
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGGGACATCTGTCTTTATCAGTGGCTGGGGCGCCACTAGAGAAGGAGG[T/G]CAGCAAAAAAGCTTAGAACTCATAACTTTGTCCTGGTGTGTGATTTCATT
Associated Phenotype:
Not determined