Busch Lab

ZMP

wu:fo94f09

Ensembl ID:
ENSDARG00000061147
ZFIN ID:
ZDB-GENE-031118-80
Description:
Wu:fo94f09 protein [Source:UniProtKB/TrEMBL;Acc:Q1RLQ7]
Human Orthologue:
ZFP64
Human Description:
zinc finger protein 64 homolog (mouse) [Source:HGNC Symbol;Acc:15940]
Mouse Orthologue:
Zfp64
Mouse Description:
zinc finger protein 64 Gene [Source:MGI Symbol;Acc:MGI:107342]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa37772 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37772
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086879 Nonsense 563 666 6 6
Genomic Location (Zv9):
Chromosome 23 (position 38920912)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 38885983
GRCz11 23 38817709
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTGTTCAGCGTCTGCTTCTGAAGCCACGCACACCTTCATTACATCCTG[T/A]TCTGACCTGGAAAGCCTCCATAAGCTCATCCAGGAGGGTGGGACTGAGGT
Associated Phenotype:
Not determined