Busch Lab

ZMP

si:ch211-212m21.5

Ensembl ID:
ENSDARG00000061140
ZFIN ID:
ZDB-GENE-030131-9807
Description:
Collectin-12 [Source:UniProtKB/Swiss-Prot;Acc:A5PMY6]
Human Orthologue:
COLEC12
Human Description:
collectin sub-family member 12 [Source:HGNC Symbol;Acc:16016]
Mouse Orthologue:
Colec12
Mouse Description:
collectin sub-family member 12 Gene [Source:MGI Symbol;Acc:MGI:2152907]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa39850 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39850
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086863 Nonsense 195 720 5 10
ENSDART00000130070 Nonsense 195 740 5 10
Genomic Location (Zv9):
Chromosome 2 (position 31143579)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31444639
GRCz11 2 31427857
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACAGAAACGGCGAGACTCCAGTCAGATCTCCATGTACAGACAAGTGAA[C/T]AGGGCCAAAACAGCCACAGCATCAGCACTCTAAACTTTACCCAGACCCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3398
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086863 Nonsense 264 720 5 10
ENSDART00000130070 Nonsense 264 740 5 10
Genomic Location (Zv9):
Chromosome 2 (position 31143787)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31444847
GRCz11 2 31428065
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAAGCAGATGCTGATTGGCTGAGAGAGAAGGTGCAGAACCTTCAGGCTT[T/A]AGCGGCTAATAATTCTCTGCTGACTCGCTCTAACAGTGACTCTCTAGAGG
Associated Phenotype:
Not determined