Busch Lab

ZMP

si:ch211-239j15.4

Ensembl ID:
ENSDARG00000061138
ZFIN ID:
ZDB-GENE-060531-45
Description:
hypothetical protein LOC100006377 [Source:RefSeq peptide;Acc:NP_001116418]
Human Orthologue:
SENP7
Human Description:
SUMO1/sentrin specific peptidase 7 [Source:HGNC Symbol;Acc:30402]
Mouse Orthologue:
Senp7
Mouse Description:
SUMO1/sentrin specific peptidase 7 Gene [Source:MGI Symbol;Acc:MGI:1913565]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa1021 Nonsense Available for shipment Available now
sa24195 Nonsense Available for shipment Available now
sa45774 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa5008 Nonsense F2 line generated Not yet available
sa43869 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa1021
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086868 Nonsense 20 879 2 22
Genomic Location (Zv9):
Chromosome 22 (position 30421572)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28288996
GRCz11 22 28239117
KASP Assay ID:
554-0925.1 (used for ordering genotyping assays)
KASP Sequence:
TTGGACTAACCTTATTGCAGTTACTTTTTTTGCAGATGGCGGTGTCCTTT[C/T]GAATCCCCAAAAAGAAGCAGCCGTCAGATTCCTGCAGTCTTGATATGCAG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa24195
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086868 Nonsense 417 879 11 22
Genomic Location (Zv9):
Chromosome 22 (position 30395132)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28315436
GRCz11 22 28265557
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGTAGCCATTAGCATTTCATGCTCTCAACTTCAAATGTACGGCATGT[G/A]GGATGGTGGACTGGCCAGTGACGGCAGTCTGTTATCCATCACAGAGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45774
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086868 Essential Splice Site 542 879 12 22
Genomic Location (Zv9):
Chromosome 22 (position 30376010)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28334558
GRCz11 22 28284679
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCACTGCTGGGGCAAAACTGCAAGGACACGGGCCAGGACAAAGCAAAG[G/A]TCAGCCTATCAATACAATTTGTTGTTTCATGCTTTCTGTTTGTCAGTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5008
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086868 Nonsense 662 879 16 22
Genomic Location (Zv9):
Chromosome 22 (position 30366553)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28344015
GRCz11 22 28294136
KASP Assay ID:
554-3600.1 (used for ordering genotyping assays)
KASP Sequence:
TTTCCTGCAGGTCTGCGTACAGACGACATCAGAGAGTGAGAACGTGGACA[C/T]GAYATGTGGACATATTTAGCAAAGACTACCTTTTTATACCAGTTAATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43869
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086868 Nonsense 702 879 17 22
Genomic Location (Zv9):
Chromosome 22 (position 30362965)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28347603
GRCz11 22 28297724
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGATCTGTTTTCCTGCTCTGGAAAGGCCTCAGATTGTAGAGTGGAGA[C/T]AAAAAAGCTCAGTGTCCCAGGATGAAAGCCAGACCACCAAAGAGAGACCC
Associated Phenotype:
Not determined