Busch Lab

ZMP

si:ch211-209p5.2

Ensembl ID:
ENSDARG00000061121
ZFIN ID:
ZDB-GENE-030131-7856
Description:
Novel protein similar to vertebrate latrophilin 3 (LPHN3) [Source:UniProtKB/TrEMBL;Acc:A8E7J9]
Human Orthologue:
LPHN3
Human Description:
latrophilin 3 [Source:HGNC Symbol;Acc:20974]
Mouse Orthologue:
Lphn3
Mouse Description:
latrophilin 3 Gene [Source:MGI Symbol;Acc:MGI:2441950]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa24843 Nonsense Mutation detected in F1 DNA Not yet available
sa11206 Nonsense Available for shipment Available now
sa11727 Nonsense Available for shipment Available now
sa19494 Nonsense Available for shipment Available now
sa19493 Essential Splice Site Available for shipment Available now
sa19492 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24843
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042366 Nonsense 3 162 1 3
ENSDART00000086797 None None 1346 None 19
ENSDART00000144208 Nonsense 3 1516 2 21
ENSDART00000146871 None None 1098 None 16
Genomic Location (Zv9):
Chromosome 1 (position 21884896)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22420063
GRCz11 1 23110802
KASP Assay ID:
554-7821.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGTCCTTTCTTTTTTAGGTGTGCGCGTCAGAAAGAAGCGCAATGGCTT[T/A]AACGTGTCCGAGACGCAGCTTCAGCGAGTCAGTGCAGAGGTCAACAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11206
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042366 None None 162 None 3
ENSDART00000086797 Nonsense 3 1346 1 19
ENSDART00000144208 Nonsense 192 1516 5 21
ENSDART00000146871 None None 1098 None 16
Genomic Location (Zv9):
Chromosome 1 (position 21846727)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22381894
GRCz11 1 23072633
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
RTGGTGTAAGGACCCCTTACAGTCATCCAATAAGATCTACTACATGCCCT[G/A]GACACCGTATCGCACAGACACACTGACTGAGTATTCAWCTAAGGAGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11727
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042366 None None 162 None 3
ENSDART00000086797 Nonsense 321 1346 2 19
ENSDART00000144208 Nonsense 510 1516 6 21
ENSDART00000146871 Nonsense 92 1098 1 16
Genomic Location (Zv9):
Chromosome 1 (position 21814180)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22349347
GRCz11 1 23040086
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCACTGCTGAAATCTCCTGGCCACGGACACACCAGGGAMAAGYTGCTAAG[C/T]AACCGTGCCCACCTGGCACCATAGGTTAGTAAGAGAGTGATTAATCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19494
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042366 None None 162 None 3
ENSDART00000086797 Nonsense 462 1346 6 19
ENSDART00000144208 Nonsense 638 1516 9 21
ENSDART00000146871 Nonsense 220 1098 4 16
Genomic Location (Zv9):
Chromosome 1 (position 21794309)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22329476
GRCz11 1 23020215
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTGCAGGTGCGATCTCAGGCGGCGTGGAGAGAGCTTTCTGTAGCCGAG[C/T]AGCTGCGATGCGCAACCATGCTCCTGGACACGGTGGAGACGGGAGCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19493
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042366 None None 162 None 3
ENSDART00000086797 Essential Splice Site 737 1346 11 19
ENSDART00000144208 Essential Splice Site 913 1516 14 21
ENSDART00000146871 Essential Splice Site 495 1098 9 16
Genomic Location (Zv9):
Chromosome 1 (position 21762256)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22297423
GRCz11 1 22988162
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTAGATAGTTTGAGCAGCGTTTGTGCTCTGTGTGTATGTCTTTGTTAC[A/T]GATCGTCTGCGCTGTGTTTGCGGCCCTGCTGCATTTCTTCTTCTTGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19492
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042366 None None 162 None 3
ENSDART00000086797 Nonsense 805 1346 11 19
ENSDART00000144208 Nonsense 981 1516 14 21
ENSDART00000146871 Nonsense 563 1098 9 16
Genomic Location (Zv9):
Chromosome 1 (position 21762048)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22297215
GRCz11 1 22987954
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCCAGCTGTCATAGTAGCTGTATCGGCTGCTGTGGACTACCGTAGCTA[C/A]GGCACTGAAAGAGTGTAAGTAAATGACAGATCTATTTCCCATGGTAAAAT
Associated Phenotype:
Not determined