Busch Lab

ZMP

nars

Ensembl ID:
ENSDARG00000061100
ZFIN ID:
ZDB-GENE-030131-1016
Description:
Novel protein similar to vertebrate asparaginyl-tRNA synthetase (NARS) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
NARS
Human Description:
asparaginyl-tRNA synthetase [Source:HGNC Symbol;Acc:7643]
Mouse Orthologue:
Nars
Mouse Description:
asparaginyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:1917473]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa37195 Nonsense Mutation detected in F1 DNA Not yet available
sa32322 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37195
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086746 Nonsense 152 603 5 15
ENSDART00000144766 Nonsense 105 556 5 15
Genomic Location (Zv9):
Chromosome 21 (position 1086639)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 791427
GRCz11 21 950511
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTGTTTTGGCAGGCTGAAGATGCCGAACGCAGAGAGAAGAATCTGGAA[G/T]AAGCAAAAAAGATCACGATTGAGAACGACTCCAGCCTTCCCGAACCCAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4149
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086746 Essential Splice Site 169 603 5 15
ENSDART00000144766 Essential Splice Site 122 556 5 15
Genomic Location (Zv9):
Chromosome 21 (position 1086584)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 791372
GRCz11 21 950566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAAAAGATCACGATTGAGAACGACTCCAGCCTTCCCGAACCCAAAACTG[T/A]GAGCATTTACTGAATTRCACGCAGTATATTGAGTATAYAGTAGGGCTSCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29488
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086746 Nonsense 330 603 10 15
ENSDART00000144766 Nonsense 283 556 10 15
Genomic Location (Zv9):
Chromosome 21 (position 1077467)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 782255
GRCz11 21 959683
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTGTTGTTTTGTTTGTGTGCTCCTCAGATAACTCCGCCCACTCTGGTG[C/T]AGACGCAGGTGGAGGGCGGATCCACGCTCTTCGGTCTCAACTATTTCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32322
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086746 Nonsense 468 603 12 15
ENSDART00000144766 Nonsense 421 556 12 15
Genomic Location (Zv9):
Chromosome 21 (position 1074902)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 779690
GRCz11 21 962248
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCGACTGGCTGAAAGAGCACAACATCAAGAAAGACGACGGCACCTTTTA[T/A]GAGTTTGGAGAGGTTTGTTCATGTCTCATATATTACAACCTTGAGTGCTC
Associated Phenotype:
Not determined