Busch Lab

ZMP

c2cd2l

Ensembl ID:
ENSDARG00000061066
ZFIN ID:
ZDB-GENE-041019-1
Description:
C2 domain-containing protein 2-like [Source:RefSeq peptide;Acc:NP_001070851]
Human Orthologue:
C2CD2L
Human Description:
C2CD2-like [Source:HGNC Symbol;Acc:29000]
Mouse Orthologue:
C2cd2l
Mouse Description:
C2 calcium-dependent domain containing 2-like Gene [Source:MGI Symbol;Acc:MGI:1919014]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa33628 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33628
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086686 Essential Splice Site 153 708 3 15
ENSDART00000142958 Essential Splice Site 157 712 4 16
Genomic Location (Zv9):
Chromosome 5 (position 32200568)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29961398
GRCz11 5 30561551
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCGTCCATTGACCGTGTGACTTGCACTGACCAATCAGTACGCAGCATGG[T/A]AAGAATTAAGGCCATTGCTTAGTTTTGGAGGCTGGTGGGTATTGTTGTTG
Long Flanking Sequence:
ACCTGTTTTCTCTTCCACTCACCCGGAATGATGACTGTTTCATATTTCCTCTCACTTTTAGCACTGCTTGATTTATGCAGATTTTAATTAAAAGGGGCGTTTTTCGATTTATCCCTTGCTCTTCATATAATTGCGAGAGACGCATTGCCGTGAATATAAAGAAGAACATACTGCAATGCTTCGGTTGCTTATTTATTATTCTACTTCATCACAGGGTGGCTGGGATTTCTGTTTTGAAACTGTGAAGATTTATGGATGCACCATCATCTAGCTTCTTAATATAAACATGCAAATATAAATTTGGCTCGAGAGGCACATCCGAAGAGTGATTGCACACACAGAGGGTTTTTATTCAGTGATTTATGTGCAGATGAAGTAACTGACTATCTCCATTTCCTTTCAGAGCTCCATTCAAATCACCTTTGATGACAGCCTTCAACTACCAACTTCTGCGTCCATTGACCGTGTGACTTGCACTGACCAATCAGTACGCAGCATGG[T/A]AAGAATTAAGGCCATTGCTTAGTTTTGGAGGCTGGTGGGTATTGTTGTTGTCAGTTTATTAGGCTTATATGAAAGCAGCTCTGATCCACTGCAAAACATATGGGTTTGTGTAATGGCAGCCACCAATAAAGTCCTGCAGTGAATGCACACGTCTGAGCTACAGCAGTGAGCGGGTGCTTTGAGCACAAAACCCCAGAGAGCAGTGCACGTCGGACAGTTTATCAAGGATGTATCGCTGGATCGCGTCTCACTATAGTTGTCAAACGTGATATTTAATTAACCTTGTTTCTATTTAACAACTCTTTGGTCTTTTGAATCTATGAGGTAACGTGTCATAGCGTCAGTACACTGCTTCAAACTTTCGCTTTCACGCTTGTACTTAATAATTTTAGTGAAAACCTCAGATACTTTTGGTTGGGTGCTGTTGTTGGATGCCTTTTTTACCAACCAAGTTTGTCAATGCCATTATAACGACACAGTTCACTCTGCCTATTTATGCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8191
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086686 Nonsense 290 708 7 15
ENSDART00000142958 Nonsense 294 712 8 16
Genomic Location (Zv9):
Chromosome 5 (position 32193153)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29953983
GRCz11 5 30554136
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAAGCAGATTGGTGGTCTWAACTCTCCATCTCAGAGCACACCAGGCAGG[C/T]GAATACTGGTGCACCAACTCAGAGCAAGCAATGTCAAAAAAGGTATGCAA
Long Flanking Sequence:
GAAGGAGGTGAGGGAGTCATTTTAGGCACATAGATCATGTTCCCTTTTAGCTTGTCATCTTGTGGTTTGTAAAAATGGCACCGAAAGGAACTACTTTTTTGAGCTATGCAAATAAACTTAAGTCTGTTTTTATCTTGAGGGCTCTGATGTGGAGGTGGACAGCGATATGATTGCTGCTCTGGTGGAGGACACGCTGTACACAACGCACCCTGCCATGATCCTCAACCTGAGAGCCTGTGTATCAAGCCCTGCGGTAAAAATACCAGTATCGATTGCTATATCACACAGTAGGGGTTATGACCATGCAGTGGGTCAGTGTGGCGAGCATTTGAAACTCTACTGAGTAATGGGACAATGCTGTGTGTTTAGATTTTGGTGTATTTGAAGATGGAATATGCTTTTGGTATTTTTTGAAACTTTCACGTTCTTTGCTATTGTAGTTTCCCAGGGAAAAGCAGATTGGTGGTCTTAACTCTCCATCTCAGAGCACACCAGGCAGG[C/T]GAATACTGGTGCACCAACTCAGAGCAAGCAATGTCAAAAAAGGTATGCAATTTTGCCACAAATGGGCTGTCTGTTCAAATTAAATGACTCTACATATTAAAAATCAGATACTTGTCTGAGGCCACGTTTACAGTAATACATTTTAGTTTCAAAACGGTGCTGTAGAATGAAAACAATTCGATTCACACTGGCGTTTCACCTAGCATTTCTGAAAATATCTTCATCCACACTATACTGCTGAAAATGCAAATCACATGACCACACACACACTCTGGCTTGCGCTGCAGGATATGCAGAGATCTCCGCTCCAGGTAGTCAGTGGATGCTTTGAGCACAACTCCCCAGGTGGGAGCAGCGCACGTTGGACGGTTCATAAAGGATGTTTTCCTGGATGTCATCTCACTATAGTCGTTAAATGTGATATTTAATTCATCTTGTTGTCTATGTCTAATGACTCCTTGGTCTTTTGAATCGATTACTTGTTCTTAGGTAACGTGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26499
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086686 Essential Splice Site 304 708 7 15
ENSDART00000142958 Essential Splice Site 308 712 8 16
Genomic Location (Zv9):
Chromosome 5 (position 32193109)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29953939
GRCz11 5 30554092
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCAGGCGAATACTGGTGCACCAACTCAGAGCAAGCAATGTCAAAAAAGG[T/C]ATGCAATTTTGCCACAAATGGGCTGTCTGTTCAAATTAAATGACTCTACA
Long Flanking Sequence:
TTTTAGCTTGTCATCTTGTGGTTTGTAAAAATGGCACCGAAAGGAACTACTTTTTTGAGCTATGCAAATAAACTTAAGTCTGTTTTTATCTTGAGGGCTCTGATGTGGAGGTGGACAGCGATATGATTGCTGCTCTGGTGGAGGACACGCTGTACACAACGCACCCTGCCATGATCCTCAACCTGAGAGCCTGTGTATCAAGCCCTGCGGTAAAAATACCAGTATCGATTGCTATATCACACAGTAGGGGTTATGACCATGCAGTGGGTCAGTGTGGCGAGCATTTGAAACTCTACTGAGTAATGGGACAATGCTGTGTGTTTAGATTTTGGTGTATTTGAAGATGGAATATGCTTTTGGTATTTTTTGAAACTTTCACGTTCTTTGCTATTGTAGTTTCCCAGGGAAAAGCAGATTGGTGGTCTTAACTCTCCATCTCAGAGCACACCAGGCAGGCGAATACTGGTGCACCAACTCAGAGCAAGCAATGTCAAAAAAGG[T/C]ATGCAATTTTGCCACAAATGGGCTGTCTGTTCAAATTAAATGACTCTACATATTAAAAATCAGATACTTGTCTGAGGCCACGTTTACAGTAATACATTTTAGTTTCAAAACGGTGCTGTAGAATGAAAACAATTCGATTCACACTGGCGTTTCACCTAGCATTTCTGAAAATATCTTCATCCACACTATACTGCTGAAAATGCAAATCACATGACCACACACACACTCTGGCTTGCGCTGCAGGATATGCAGAGATCTCCGCTCCAGGTAGTCAGTGGATGCTTTGAGCACAACTCCCCAGGTGGGAGCAGCGCACGTTGGACGGTTCATAAAGGATGTTTTCCTGGATGTCATCTCACTATAGTCGTTAAATGTGATATTTAATTCATCTTGTTGTCTATGTCTAATGACTCCTTGGTCTTTTGAATCGATTACTTGTTCTTAGGTAACGTGTTTTGTCTGAGTGTTAAGAAGGTAATATATTAATTTATGCAACCACT
Associated Phenotype:
Not determined