Busch Lab

ZMP

si:dkey-72l14.3

Ensembl ID:
ENSDARG00000061044
ZFIN ID:
ZDB-GENE-060526-332
Description:
hypothetical protein LOC562480 [Source:RefSeq peptide;Acc:NP_001038450]
Human Orthologue:
HYAL3
Human Description:
hyaluronoglucosaminidase 3 [Source:HGNC Symbol;Acc:5322]
Mouse Orthologue:
Hyal3
Mouse Description:
hyaluronoglucosaminidase 3 Gene [Source:MGI Symbol;Acc:MGI:1330288]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6100 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21305 Nonsense Available for shipment Available now
sa7138 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6100
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086601 Essential Splice Site 171 505 1 4
ENSDART00000135456 Essential Splice Site 171 505 2 5
Genomic Location (Zv9):
Chromosome 8 (position 26830360)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25958278
GRCz11 8 25977417
KASP Assay ID:
554-3726.1 (used for ordering genotyping assays)
KASP Sequence:
GAGRATTTTTTCCAGATTGGAGTGTAGAGGAAGTGGAGAAATGGTCTCAG[G/A]TGATGACATTTNAATAAAGTATAGAAACTAAAGCTGTATACAAAATCAYY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21305
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086601 Nonsense 312 505 3 4
ENSDART00000135456 Nonsense 312 505 4 5
Genomic Location (Zv9):
Chromosome 8 (position 26827859)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25955777
GRCz11 8 25974916
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATGTATGTACTGTATGATTTACAGGCTGACCTGGTGAATACAATTGGA[G/T]AGAGTGCTGCTATGGGAGCATCTGGAGTCATTATATGGGAAAAATCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7138
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086601 Nonsense 378 505 4 4
ENSDART00000135456 Nonsense 378 505 5 5
Genomic Location (Zv9):
Chromosome 8 (position 26826958)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25954876
GRCz11 8 25974015
KASP Assay ID:
554-4924.1 (used for ordering genotyping assays)
KASP Sequence:
GYGGGGTCTCTCTGTGYCAAGGCCGYGGACGATGTGTGCGCAAGAAACCC[G/T]AGGACCCCACATACCTGCATCTTCCCTCAGCTCACTTTATGCTGATCCCA
Associated Phenotype:
Not determined