Busch Lab

ZMP

si:dkey-190l1.2

Ensembl ID:
ENSDARG00000061042
ZFIN ID:
ZDB-GENE-060503-620
Description:
gamma-aminobutyric acid type B receptor subunit 2 [Source:RefSeq peptide;Acc:NP_001137515]
Human Orthologue:
GABBR2
Human Description:
gamma-aminobutyric acid (GABA) B receptor, 2 [Source:HGNC Symbol;Acc:4507]
Mouse Orthologue:
Gabbr2
Mouse Description:
gamma-aminobutyric acid (GABA) B receptor, 2 Gene [Source:MGI Symbol;Acc:MGI:2386030]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa39253 Nonsense Mutation detected in F1 DNA Not yet available
sa43313 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19217
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086617 Nonsense 588 935 13 19
Genomic Location (Zv9):
Chromosome 19 (position 36159211)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35023731
GRCz11 19 34610851
KASP Assay ID:
2261-3504.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAATCACCTCGTCCATTACTTTTCTCTCTTTTTCCCCTTCCAGATTATC[A/T]AGGACCAGAAGCTCTTTATCATCGTGGGAGGGATGTTGCTGATTGATTTG
Long Flanking Sequence:
TCATGATCTTGTGCTATTTCAAATGTCTGACCATTTAATGAAACCATCAACCTCTGTTTGACTGAAGATAAAGAGCATCCGCTCTGATAGGGTTCTGCTTTTAGCTCAGTGCTCACATAGTAACCCACCACTGCCTTGATCCTTATGATGCAAGATTTTGGCTGTTGGTAAGCCATCGGATCAAAACAAGTTAGCGTTTCTATTCGGAATCATGGAAGAATTTGTTCGTTCCCTCTGTTTGCTTTCTCTAGTATACACACAGGCCTCCTCGCGGTGACCTTTCCTTTGATTTGGGTTATGTTTAGGTCAACCACTGTTAAATAGAAGAAAAGAGGAAAAGATCAGACAGGAGCAGTGCTTTCATCCACAAAGGTTCAAAATGCGAGAGGAGATCATTGAGCCAATGCCCCATTGATGGTTCCTGTCCATCTCTGTCTTTTTCTCATCCCCTTAATCACCTCGTCCATTACTTTTCTCTCTTTTTCCCCTTCCAGATTATC[A/T]AGGACCAGAAGCTCTTTATCATCGTGGGAGGGATGTTGCTGATTGATTTGTGCATCCTCATATGCTGGCAGATCGTGGATCCCCTGAAGAGAACTGTGGAAGAGTACAGCTTGGAGGCGAGTCTGATTGCTTATTATTAATGTTGTATGTAACGATTCAGCAGAATCCCTCGACCGGGTTGTAATGGTTAATCAATTCCAACTAAATCATAGTCACAGGGAGTTGGGATCATCGGGGAACATGCAGTGGCCAAGTTTTATTACCATCTGGGTTATTTTTGGGATCAGGAAATGAGACGTTCTGACCCGCCCCTACATCCACGGTGGTTGAAGACGTAGGCCAGCTGGAATGTGGCACATTGGCACAATTGCTTGGAAAAAAAAGACATTTGGACGAGTCTGTACCGTGCTGTCACGCAGAGGGGGACGCATGTGATTGAGCAGGGTTTCAAAATAGGCTGGACATTTTGAACGTCTGCTTGCTTTAGTCATGTGCGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39253
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086617 Nonsense 666 935 15 19
Genomic Location (Zv9):
Chromosome 19 (position 36223228)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35087748
GRCz11 19 34674868
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCCTGTGATGATAAATATTCTTGCCCTTTTCTCTTTGTCTAGTTGTTC[G/T]GATGTTTCTTGGCCTGGGAGACGAGAAACGTGAGCATCCCAGCACTGAAC
Long Flanking Sequence:
ACATCAGAGCACCTTAGAAACCACTTAGAAACATGATTTCAAAACACTCAGAACAACTTAGCAAACGTTATAAGAGAGGATAAAACCCACAGAACACCATAACAACTACTTTGAATCATAGTAAAAAAGATCAGAGCACCTCAGAAACCCCTTTAGAAACATGATTAATATAAACTCTTAACACCTTAGCAACCAATTAAAATTGTGATAAAACCCTCAGAACACCATGGCAACCACTTAGAAACAACGTAAAACATCAGAACTCCTAAAAAAACACTTAGAAACATATTAAAAACCCTCAGAAAACCTTAGTAACCACACATAATAAAAAATAAGATAGAAACTACCTAAAATACCTTAGCAACAATGTGGCAACATCTATTCCTGGGTTGTGTCACCAACTTCCTTCAGATAAGGTAAACATCTGCTTGCAAATCTGCCCCTGCCTCTATGCCTGTGATGATAAATATTCTTGCCCTTTTCTCTTTGTCTAGTTGTTC[G/T]GATGTTTCTTGGCCTGGGAGACGAGAAACGTGAGCATCCCAGCACTGAACGACAGCAAGTACATCGGTATGAGTGTGTACAATGTGGGCATCATGTGCATCATCGGGGCAGCGGTGTCCTTCCTGACTCGGGATCAGCCTAATGTTCAGTTCTGCATTGTGGCCCTGGTCATCATTTTCTGCAGCACCATCACGCTGTGTCTGGTATTTGTGCCAAAAGTAAGTACTGCAATGCTCCGCCTGATCCGGCCCAATGGGAAAAGAATTGTAGAGGTCAGCGAAAGGCCCTTTCTGGCATTTGATTTGTGCAAATCCCTAGCAAGTTCACCTGAATATAATTGAGAACCGTGCTTACTTTGCATCCCCTGGAGCTCTCTGGAAATAAACACAACGGAATTTGAAAGAGTAGAAAGATTAGACTCTCTCTCACTCTAAACAAATACATCTTACATCGAGTTAGCCTCACCATCTCAACTGTCTGCCTTTGTCTTCTCTCTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43313
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086617 Nonsense 922 935 19 19
Genomic Location (Zv9):
Chromosome 19 (position 36228054)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35092574
GRCz11 19 34679694
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGCAAGTTGCAGCAGTCCCACAAGCAGCCCATCCTCCAGTCCCCGCCAC[A/T]GACACATGCCTCCCTCCTACAGGGTCATGGTGTCCGGCCTGTGAGCCCTT
Long Flanking Sequence:
ACACCTTACTCCTTTGCCATGCAACCAGAAACCGCCAAACTAGATACATATTGAATTTTAGTTTAGTCCTGGCTGATGGCACAAGAAGAACAAGATCAGGACCAAATCCTTTACAAGCAACTATTGTAAAACGACCTCAAACTTTTAAATAATAGTGAAGGTCTAGATGGTGTAGTTAGGGCAACTACCAGCAGGATCTAATGGTGTCATAGTAACCCTAAACCCTATATTAAGACGAGAATGCAACGTGCAAGGCAAAATCACTGTTGCTTTAAATGTACTCTGTAAACTTCTGTTCTAAAAATCATCACAGGAAATGGAGAATTTTCTGCATTTTATGCAAATAAATCATTTTCTTCCCTGTCATTTGTGTTCGCAGCATACAGCGCCGGCTATCCTTGCAGCTGCCAATCCTGCATCATGCCTATCTACCCTCCATAGGAGGTGTGGACGCAAGTTGCAGCAGTCCCACAAGCAGCCCATCCTCCAGTCCCCGCCAC[A/T]GACACATGCCTCCCTCCTACAGGGTCATGGTGTCCGGCCTGTGAGCCCTTGCCCTGACCTGCACTACACTCCGAGGAAGCGATCAGCTTTTTTATTTTAAGACAGACTGAGCAATATCAGCGGTTAACAGAAGCGTGTGAGCAACCCGGGGGGGTCCAAGTCCTCATGCATCCATGACCCCCTTCCACCATCCATGGCCACATCAGAGCAGAACTGATCTTTCAGGCTAGGAGGGAGGTGACTGGAGGTCCTCACACAGCAACTCAACCCAGACTCCAATCCTCTCGTTCCTGTCACCTCCCAATCCTATCTCAATTAACTCAACACTCCCCCAAAACAGCAACACGGACCAATGGAGGACAGGAGCTGTAGCCTTACCAGCTAATAAAAAGACACTTCTGTTGTTAGCCTTTCTGTGCACATCAGTTCTGCTGGAACTTGTGGGAAAGGGGCAACGGATGTGACCGAGAACTCCTCCTCATTACTCACCACTTCAACAG
Associated Phenotype:
Not determined