Busch Lab

ZMP

si:ch1073-351m12.1

Ensembl ID:
ENSDARG00000061040
ZFIN ID:
ZDB-GENE-081031-76
Description:
pumilio homolog 2 [Source:RefSeq peptide;Acc:NP_001096040]
Human Orthologue:
PUM2
Human Description:
pumilio homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:14958]
Mouse Orthologue:
Pum2
Mouse Description:
pumilio 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1931751]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa11527 Nonsense Available for shipment Available now
sa43381 Nonsense Mutation detected in F1 DNA Not yet available
sa36965 Nonsense Mutation detected in F1 DNA Not yet available
sa29304 Nonsense Mutation detected in F1 DNA Not yet available
sa36964 Nonsense Available for shipment Available now
sa36963 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11527
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086578 Nonsense 21 1206 1 25
ENSDART00000145964 Nonsense 21 422 2 8
Genomic Location (Zv9):
Chromosome 20 (position 6177428)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6082702
GRCz11 20 6126560
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATGCAGCATCCTAGGTATGAATGACGTACCCTGGCAGGAGACACAATGT[G/T]GAACGCTGCACACCAATGGTGCACCAGAAACTGGTGGGGTCAGAGTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43381
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086578 Nonsense 87 1206 1 25
ENSDART00000145964 Nonsense 87 422 2 8
Genomic Location (Zv9):
Chromosome 20 (position 6177230)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6082504
GRCz11 20 6126362
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTTCTGAGTGGTCGTTCACAAGATGATGCCACTGTGGGCTATTTCTTT[C/T]AAAGGCAGCCTGGAGAGCAAATGGGAGGCTGCACTGGCAACAAACACCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36965
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086578 Nonsense 185 1206 4 25
ENSDART00000145964 Nonsense 185 422 5 8
Genomic Location (Zv9):
Chromosome 20 (position 6173260)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6078534
GRCz11 20 6122392
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTGTTGTGTATAGATCATGCTCTCTCTCAACCCATTATGGTGCAGAAG[C/T]GACCAGGCCAAGGCTACAATGGGACTGGAGAGACGAGCTCAGTGCTGTCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1256
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086578 Essential Splice Site 391 1206 6 25
ENSDART00000145964 Essential Splice Site 391 422 7 8
Genomic Location (Zv9):
Chromosome 20 (position 6168501)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6073775
GRCz11 20 6117633
KASP Assay ID:
554-1171.1 (used for ordering genotyping assays)
KASP Sequence:
CTCATCAGGTGCTGCWGTCGGCCTATTTAACTACGACTCTCAACAGCAGG[T/C]ACATTATTAAATAACAAAATATTTAATTAAACTTTGCAGTTTTCAAGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29304
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086578 Nonsense 474 1206 9 25
ENSDART00000145964 None None 422 None 8
Genomic Location (Zv9):
Chromosome 20 (position 6160953)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6066317
GRCz11 20 6110352
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTCCAGCTGTAGTTCCGCCCCAGTACTATGGGGTCCCTTGGGGTGTGTA[T/A]CCAGCCAATCTCTTCCAACAACAAGCTACAGCTGCTGCCAGTCATTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36964
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086578 Nonsense 617 1206 12 25
ENSDART00000145964 None None 422 None 8
Genomic Location (Zv9):
Chromosome 20 (position 6153948)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6059312
GRCz11 20 6103347
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAGTATGTCTGGTCCTGCTAATGGTCTATACCGGTCCATGGCATGCCAA[C/T]AACCCCAGCAGCCTCAACCTCAGCAGCAGCTTCCTCCACCTTCCAGCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36963
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086578 Nonsense 1174 1206 25 25
ENSDART00000145964 None None 422 None 8
Genomic Location (Zv9):
Chromosome 20 (position 6140207)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6045571
GRCz11 20 6089606
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATCTTGTCAATTCCAGATCCGGCCACATATTGCCACTCTCCGGAAATA[T/G]ACATATGGAAAGCACATCCTGGCTAAGCTGGAAAAGTACTACATGAAGAG
Associated Phenotype:
Not determined