Busch Lab

ZMP

si:dkey-7b17.4

Ensembl ID:
ENSDARG00000061017
ZFIN IDs:
ZDB-GENE-030131-5843, ZDB-GENE-060531-154
Description:
Protein spinster homolog 2 [Source:UniProtKB/Swiss-Prot;Acc:A2SWM2]
Human Orthologue:
SPNS2
Human Description:
spinster homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:26992]
Mouse Orthologue:
Spns2
Mouse Description:
spinster homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2384936]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa2192 Nonsense F2 line generated Not yet available
sa10870 Nonsense Available for shipment Available now
sa20453 Nonsense Available for shipment Available now
sa1096 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa2192
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086564 None None 503 None 12
ENSDART00000111749 Nonsense 50 501 1 13
Genomic Location (Zv9):
Chromosome 5 (position 32563042)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30323872
GRCz11 5 30924025
KASP Assay ID:
554-2455.1 (used for ordering genotyping assays)
KASP Sequence:
GAGATCTGCATCACTGCAGACCTGGGCAGAAATTCCATGCCGCATTACTC[C/T]GATGCCGGACTCCGCTTGTAGCCGCCGGGATTCTGAGTTTTGGAAATGTG
Long Flanking Sequence:
AAAACAATGAAACTTCGCACGAGCTAACAATTTCGGTGACATTCTTCTCTTCTCATGATCATTCCGCGCACACACTCCTAGACTCGCAGAATTGAATGGGCGTGGCTTGGAGAGCACGCCTCCCTCCACTACACTCCACAGAGGAGCGCAGACCGAGCGCTCAATGCTGTCAATGTACAGACATGAACCGAGCTCAGCGAGCAATAATCAAATCAAAGCTTTTTATTCTCCGCGATTAACACTTAGTTTTTTCCGTTTTCCGCTAATAGGTTCAACACAATTTTTCCACCTTAACCGTCGTTTTGGAAAACAAAATCGTTCAATCGTTTGCGCTGGATCTTTCTTGCCAGAAGATGTGTGTGGAGAGCGATGGATGTGAAATCGAGGGGTGCAGCAGTTCGGATGAGGTGCACACGCTGTCTGGAAGCATGAGTCCGGCTCTTAAATCCAGAGATCTGCATCACTGCAGACCTGGGCAGAAATTCCATGCCGCATTACTC[C/T]GATGCCGGACTCCGCTTGTAGCCGCCGGGATTCTGAGTTTTGGAAATGTGCTCAATTACATGGACAGATACACCGTAGCAGGTAAGACGAGCATTATTTTGGTGTAAAAGCCGGTCGTTTTACTAACCGGCTTATGATAGCAGAACAGCGCAAGTCATCATTTGTATTGTTTAATGTTTCACTCGGGCAACAAAGTTTCATTTTGACCAGGAAAACACAAACATTTTAAACATTAACACAAGTCAAGTGATCATCATGTATATCTCAAAGGCGCACGTGCTGGATTTTATTGAACAAGGTAAAACAGTATGTCTCTCATGCAGCTTAGCCTGTTCCGTGTGATTTAATCAAACCATCCGGATAGTGAGAGGTAACCCCGTTGTGCTAACATGATATTGATTATTGTGAGTGAACTTAGATCAATCAAATCTGACCCTATGCCTCTCAAATATGCCACAATATAAAGGCTGATGACAAGCAGTCCCATTTGCAATTTTATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26501
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086564 None None 503 None 12
ENSDART00000111749 Nonsense 64 501 1 13
Genomic Location (Zv9):
Chromosome 5 (position 32563000)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30323830
GRCz11 5 30923983
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTACTCCGATGCCGGACTCCGCTTGTAGCCGCCGGGATTCTGAGTTTT[G/T]GAAATGTGCTCAATTACATGGACAGATACACCGTAGCAGGTAAGACGAGC
Long Flanking Sequence:
TCTTCTCTTCTCATGATCATTCCGCGCACACACTCCTAGACTCGCAGAATTGAATGGGCGTGGCTTGGAGAGCACGCCTCCCTCCACTACACTCCACAGAGGAGCGCAGACCGAGCGCTCAATGCTGTCAATGTACAGACATGAACCGAGCTCAGCGAGCAATAATCAAATCAAAGCTTTTTATTCTCCGCGATTAACACTTAGTTTTTTCCGTTTTCCGCTAATAGGTTCAACACAATTTTTCCACCTTAACCGTCGTTTTGGAAAACAAAATCGTTCAATCGTTTGCGCTGGATCTTTCTTGCCAGAAGATGTGTGTGGAGAGCGATGGATGTGAAATCGAGGGGTGCAGCAGTTCGGATGAGGTGCACACGCTGTCTGGAAGCATGAGTCCGGCTCTTAAATCCAGAGATCTGCATCACTGCAGACCTGGGCAGAAATTCCATGCCGCATTACTCCGATGCCGGACTCCGCTTGTAGCCGCCGGGATTCTGAGTTTT[G/T]GAAATGTGCTCAATTACATGGACAGATACACCGTAGCAGGTAAGACGAGCATTATTTTGGTGTAAAAGCCGGTCGTTTTACTAACCGGCTTATGATAGCAGAACAGCGCAAGTCATCATTTGTATTGTTTAATGTTTCACTCGGGCAACAAAGTTTCATTTTGACCAGGAAAACACAAACATTTTAAACATTAACACAAGTCAAGTGATCATCATGTATATCTCAAAGGCGCACGTGCTGGATTTTATTGAACAAGGTAAAACAGTATGTCTCTCATGCAGCTTAGCCTGTTCCGTGTGATTTAATCAAACCATCCGGATAGTGAGAGGTAACCCCGTTGTGCTAACATGATATTGATTATTGTGAGTGAACTTAGATCAATCAAATCTGACCCTATGCCTCTCAAATATGCCACAATATAAAGGCTGATGACAAGCAGTCCCATTTGCAATTTTATATTATCAGCATTTCTCACGCCAGTTTTTTACGTTTGCTCACAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2254
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086564 None None 503 None 12
ENSDART00000111749 Essential Splice Site 77 501 1 13
Genomic Location (Zv9):
Chromosome 5 (position 32562959)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30323789
GRCz11 5 30923942
KASP Assay ID:
554-3439.1 (used for ordering genotyping assays)
KASP Sequence:
CTGAGTTTTGGAAATGTGCTCAATTACATGGACAGATACACCGTAGCAGG[T/C]AAGACGAGCATTATTTTGGTGTAAAAGCCGSTCGTTTTANTAACCGRCTT
Long Flanking Sequence:
TCGCAGAATTGAATGGGCGTGGCTTGGAGAGCACGCCTCCCTCCACTACACTCCACAGAGGAGCGCAGACCGAGCGCTCAATGCTGTCAATGTACAGACATGAACCGAGCTCAGCGAGCAATAATCAAATCAAAGCTTTTTATTCTCCGCGATTAACACTTAGTTTTTTCCGTTTTCCGCTAATAGGTTCAACACAATTTTTCCACCTTAACCGTCGTTTTGGAAAACAAAATCGTTCAATCGTTTGCGCTGGATCTTTCTTGCCAGAAGATGTGTGTGGAGAGCGATGGATGTGAAATCGAGGGGTGCAGCAGTTCGGATGAGGTGCACACGCTGTCTGGAAGCATGAGTCCGGCTCTTAAATCCAGAGATCTGCATCACTGCAGACCTGGGCAGAAATTCCATGCCGCATTACTCCGATGCCGGACTCCGCTTGTAGCCGCCGGGATTCTGAGTTTTGGAAATGTGCTCAATTACATGGACAGATACACCGTAGCAGG[T/C]AAGACGAGCATTATTTTGGTGTAAAAGCCGGTCGTTTTACTAACCGGCTTATGATAGCAGAACAGCGCAAGTCATCATTTGTATTGTTTAATGTTTCACTCGGGCAACAAAGTTTCATTTTGACCAGGAAAACACAAACATTTTAAACATTAACACAAGTCAAGTGATCATCATGTATATCTCAAAGGCGCACGTGCTGGATTTTATTGAACAAGGTAAAACAGTATGTCTCTCATGCAGCTTAGCCTGTTCCGTGTGATTTAATCAAACCATCCGGATAGTGAGAGGTAACCCCGTTGTGCTAACATGATATTGATTATTGTGAGTGAACTTAGATCAATCAAATCTGACCCTATGCCTCTCAAATATGCCACAATATAAAGGCTGATGACAAGCAGTCCCATTTGCAATTTTATATTATCAGCATTTCTCACGCCAGTTTTTTACGTTTGCTCACAAATCAGCACTAACAATCTGTATTTGTCTTATCAATAGCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10870
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086564 Nonsense 136 503 4 12
ENSDART00000111749 Nonsense 212 501 5 13
Genomic Location (Zv9):
Chromosome 5 (position 32476716)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30237546
GRCz11 5 30837699
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CRGTCTGGGCTACATCCTGGGATCAATTGCTAAAGATGCTGGAGGGCATT[G/A]GTACTGGGCACTGAGGGTAAGAGCTGCCGAAATGTCTCTGTGTGTTACAT
Long Flanking Sequence:
AAATGCCAACTGGTCCAGCCAGGACTCGAACCTTCTTGCTGTGAGGCGACAGTGCTAACCACTGAGCCACTCTGCCGCCCTTGACTGTTTTCAATTGTAATTAAAGTGGTCAAGTATCATAACATTCAGATGAATGAAACTAAACACATGTACCCACAGTGCATTTTTTTTCTGCTAGTGACATCACTGCTTGCAGCTATGTTTTTAAACTTTTTTTTCTTCATGTTATTGCAGGTTTATTTTGTTCTCTTGCCAATTAGCTTTTCACATAAAAACTGCCTTAAGTCTCTAAAGTAAACAATAAACTATAAAACATACAAATTCAACACTAAAACTGCCCTGGCCTATACCGGCTTAAACTAGCCAAAACCATCTGGAGTGTAGATGTTTACGCTTTGAATATGATATGTTTGCTTGTGTATAATAACATGTTTTGCTCTCTCTCCGCAGCGGTCTGGGCTACATCCTGGGATCAATTGCTAAAGATGCTGGAGGGCATT[G/A]GTACTGGGCACTGAGGGTAAGAGCTGCCGAAATGTCTCTGTGTGTTACATCAATATTTTAAAGGAAGCATGAATAACCTCCACAAATACACGCCATTTCCTCTCGTCCTGCTTAAAAATATCCCTAAAACCCATGGCAGACAGGTGAATCCCAAAATACTTTCAGCCTGTCTCTTGAAAAAGCAACAGAACATTCCTGCCCCCTTCAAGCCACTGCAATGGGCATTGACAATCCGGCAAGCTTAAGTGCATTAATTTAGCATTACCTCCAGCTCTCTTGGGTCCCGCTCACACACGCTATCCGTGAGTAATGCAGTAACAAGGTCCTCACAGTTCTCACTGTGGTCTTTGTATTACCGAGACCCAGTAGAAGAGGGGGCTCACTTACACAGGCCCTTTTGTTGCAGGCTATTCCTTAGCCTTGAGGGTTTGCCGCCCTAACCAAACGAGCCAAACTGAGCACTTTGTAATACGGCTAAAATTTGTAATTTTTGAAATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20453
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086564 Nonsense 277 503 7 12
ENSDART00000111749 Nonsense 353 501 8 13
Genomic Location (Zv9):
Chromosome 5 (position 32467464)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30228294
GRCz11 5 30828447
KASP Assay ID:
2259-5990.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCACACGACTTTGCCGTCAGAAGACGGAGCGTGCCGACCCGCTGGTGTG[T/A]GCGGTCAGCATGCTGGGTTCTGCCATCTTCATCTGCCTCATCTTTGTTGT
Long Flanking Sequence:
GTAATAATAACATGTATTTGTATAATAACATTAAAAGTGGATTTATATTTTTAGACTTTATTTTACACCACTATCTTTGTTGTTGCCAAACTGCAAAAAAAAACGAGATAAATTCATATTGATAATTTTTCTTTGTGTTTCCAGTCGTAGTTATGTATTTTCATCTCTGGCATCGGCTGCTGTGTCGTTTGCCACGGGGGCATTTGGGATCTGGATCCCACAGTACCTGGTCAGAGCTCAGGTGGTGCAAAAGTCAGCAGAGAGCTGCACATATCAACCCTGCAGCAGCAGAGACAGGTCAGAACACACACGCACACACTCCGCTTGAAAACTGATGTTCATAACAAACATTATAAGTTTGACAAAGACTACCTCTCTGCTATGTCCAGTTTAATATTTGGAGCCATCACATGTGTGACGGGGCTGCTGGGAGTGGTGATCGGTGCTGTGACCACACGACTTTGCCGTCAGAAGACGGAGCGTGCCGACCCGCTGGTGTG[T/A]GCGGTCAGCATGCTGGGTTCTGCCATCTTCATCTGCCTCATCTTTGTTGTGGCCAAGAAGAGCATAGTTGGAGCTTATGTAAGTGGATATATTTTGTGTTTGCATTCAGCTTATTACAATAAATAAATAAATAAATCAATCAATAAAATTATATTATTTATCTATACAGCTACGAAAAAAAATGTACAGACCATGTGATTTTTTAAATAAATGTTTAGCTTATTTTTTAAACCACATTATATTATCTTCAAACAACAAAATACCAATGTTTTAACTTTGGAAGATTTAAAAAGCAATATTTGGCACACCATTCTGTTTTAATTATTAATTTTATTTAATATCCTTTGTGTTTATTTCATATTCCTTGCTGATAGTAATATAATTCTTCATTTTATGTCATATTCCTTGTTATTTTCTTTTCATTATTATTTATTTATCATCATTTATTAACTATTTTTACCTTTTCTTTGTTTTGTTTTTTGCTTGTTTTGATTTGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1096
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086564 Nonsense 385 503 8 12
ENSDART00000111749 None None 501 None 13
Genomic Location (Zv9):
Chromosome 5 (position 32463259)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30224089
GRCz11 5 30824242
KASP Assay ID:
554-0998.1 (used for ordering genotyping assays)
KASP Sequence:
CGGCCATAAGCACCTTGAAAATCCAGACCAGACACTTCGGGATATCAGTT[C/A]ATTTGTGTGGGAATGCCGAAGCCAGTTAGTCTGTTCTCRTGGGATTGTGT
Long Flanking Sequence:
GGACAGCTGCTGTCTCGTCTGCATGATGCCTGATCACAATTCACACTCCTGAAGGGCTTTACAGTTTTAGCCCATCCGTCACGCCGTCTGAGCTGCAAGTCACTTTCAGGACAGAGTTTCAAACAAAAACGCACCCACTTTCATGCTTTCATTTCCTCATCTTCCATTCAGATATTCTGTAACATCAGCAAGTAAATGGAAGCTGATACTAAAACATCCACCTCATTTTTAAACACTGTGCTCATTCCTCTGTCAGCCCTGGTCAACATATCTCTCAAAACCCTGTCAGAACAACCACTTGAACGATCGAATTCCCCTGCACCCAAAGATCTCCAAACACACTGTCTCATCTGGTTTGACCCCAGCAGCTGCTGTCAGCGGCAGGACAGACCATCCACATTCTGTCAAGTCACTAAGATTAGTGGCCATATCGAATACTTGTGTCTCAATCGGCCATAAGCACCTTGAAAATCCAGACCAGACACTTCGGGATATCAGTT[C/A]ATTTGTGTGGGAATGCCGAAGCCAGTTAGTCTGTTCTCGTGGGATTGTGTGAGCCTGTTAAAATAACTTGTTAAACGTAACACGTTTTTCAGCCGCCAGACATTAAGCTCCACTCTAGTTTAATTCCAACCACTTTGTCTCTTTTAAAGAGTTTTGGAGCAGGATACTGTTGTGTTGCCCTCAAGTCAACAATGACATATAATACAGCCACAGTATAATGACATGTTTTCATATCCCACAACATTCATTGGGGTTTGTTTGATTTAGTAGATGAGCTGGATTCATTTGGTCTTTGACCGACTGCAAACCCTACTCAAATACAAACCCTAAGGACACAAATTTGTATAATGACATGGGTATGACCTAGCATTACATTGTCGATGTGGTTTATGAGGACATGTCTTGTTTCTTTGCAATTTTAAAAAAGGCTAAAAATTATACATTTTATTTTGCATGCAAAATTTGCCACAGGTTTTCTCTGAGGGATGGGTTTAGTGGTA
Associated Phenotype:
Not determined