Busch Lab

ZMP

ankfy1

Ensembl ID:
ENSDARG00000061013
ZFIN ID:
ZDB-GENE-041222-1
Description:
ankyrin repeat and FYVE domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001096142]
Human Orthologue:
ANKFY1
Human Description:
ankyrin repeat and FYVE domain containing 1 [Source:HGNC Symbol;Acc:20763]
Mouse Orthologue:
Ankfy1
Mouse Description:
ankyrin repeat and FYVE domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1337008]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa9391 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9391
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Founder:
SL4_01_G12
KASP Assay Location:
Project 554.47, Plate 5, Well E10
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086537 Essential Splice Site 112 1167 2 24
ENSDART00000147874 Essential Splice Site 112 1166 2 24
Genomic Location (Zv9):
Chromosome 5 (position 32641357)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30402187
GRCz11 5 31002340
KASP Assay ID:
2259-5997.1 (used for ordering genotyping assays)
KASP Sequence:
ATCTGGAGTTTAGCTAACCTGGCTTCCACCTCAGAACTGGACCTCTCAGG[T/G]AACAATTAGGCCTGTCTTGATATCTATKTTTTGTTCTACWATATATTGCA
Long Flanking Sequence:
GTATGACTTTATTTATGGCTAGACCTGATATGAATTTCCTGCTTCCACCTGCTGCCTCTGATTTGCAGTTTCATTTAGCTACTAAGTGCAATAAAGCCAGCTAAAATAATTTGAATATGTCTGCTTGGTCTGTAAAGTTAGGAAGTTGTATTGGAGGTGTATTTCATTATATTGCACCATGTGCTTGCGAGGTTACAGAATGATCCATCAGAGATTTGAGCTCAGACTGTTGTCTCGGATCTGACCTCACCAAGACCAATGCATAATATATAAGATCTAGTCCAGTGCCTTAAAAGATAGAGTAACTGATGACTGCATATTTCACTGGGATGCCGTGTCCTTCGATCAGTGTTTTTATGTTTTTTTTTTTCTTCTTCCAGTGATCTAAAGGTGAAGATTGGAGACCAGAGGCTCAGTGCTCATAAATTTGTACTGGCTGCTCGCAGTGAAATCTGGAGTTTAGCTAACCTGGCTTCCACCTCAGAACTGGACCTCTCAGG[T/G]AACAATTAGGCCTGTCTTGATATCTATGTTTTGTTCTACAATATATTGCACCAAAATATATTGCGAAACTATATTATTTTCATTTTAAGGACATTTTATGTCACTCATTAAATCATGCCAGAATGACAATACAATATTATCACTTGACAAAGAACACATAATATTTTATTCTTAAGATAATTTCATTTAATCATAGTCATTTTAACAATGTCATAGTTAGGCATTGGAATCAGAATGTGAAAATGCATATCCTAAATAAATAATAATTAATGTAACAGAAAAGTGCAAGGTAAAATGTAACAGAGGCTGCAATATCTGCTTCCAGATCTATTTTCAGTTGCCAGACACCCACATGAAAGTATACTACAGTAATTTATAGTAAATACCATAGTGTTTTTTAACCATACTGACACTAACACCTCCAATAGAGATAGAGAGGTTGCGCAATTAGCTAAAATGTTGCTAGAATAGTTTTTTTATGTATAGGCGATATATATTGC
Associated Phenotype:
Not determined