Busch Lab

ZMP

NP_001183988.1

Ensembl ID:
ENSDARG00000061011
Description:
hepatic leukemia factor 2 [Source:RefSeq peptide;Acc:NP_001183988]
Human Orthologue:
HLF
Human Description:
hepatic leukemia factor [Source:HGNC Symbol;Acc:4977]
Mouse Orthologue:
Hlf
Mouse Description:
hepatic leukemia factor Gene [Source:MGI Symbol;Acc:MGI:96108]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa11646 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11646
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086536 Nonsense 81 286 2 5
Genomic Location (Zv9):
Chromosome 12 (position 33847918)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 32045915
GRCz11 12 32160817
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCAACRCTTTGGGATAAAACATTGTCTTACGATGGAGACAGYTTTCAGT[T/A]GGAGTATATGGACCTTGAAGARTTTCTCTCTGAAAACGGCATCCCCTCCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3821
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086536 Nonsense 243 286 5 5
Genomic Location (Zv9):
Chromosome 12 (position 33852194)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 32050191
GRCz11 12 32165093
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAACKTGGCTGCCAAGAGATCACGAGATGCTCGGCGTCTGAAGGAAAAT[C/T]AGATTGCCATCCGGGCTGGTTTCCTGGAGAAAGAGAACATGGCCCTCCGT
Associated Phenotype:
Not determined