Busch Lab

ZMP

smyd4

Ensembl ID:
ENSDARG00000060983
ZFIN ID:
ZDB-GENE-060929-248
Description:
SET and MYND domain-containing protein 4 [Source:RefSeq peptide;Acc:NP_001070062]
Human Orthologue:
SMYD4
Human Description:
SET and MYND domain containing 4 [Source:HGNC Symbol;Acc:21067]
Mouse Orthologue:
Smyd4
Mouse Description:
SET and MYND domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2442796]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa31791 Nonsense Available for shipment Available now
sa9406 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31791
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086490 Nonsense 244 753 4 10
Genomic Location (Zv9):
Chromosome 10 (position 37275443)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36151689
GRCz11 10 36095447
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTTAATACAGGAACCAATAAGGCGGTAGAGACATTTGGTACTGAAGAT[C/T]GACATTGTCACCACTGCCTCAGCCAGTCACTGAGTTTTGTGCCCTGTCCA
Long Flanking Sequence:
ATGCTAACCGTTCTGCTGCCCTATTTTACCAAGGCCTCTACCAAGTGGGAGTCTGCTTCATGCTCTACATCAAATAATCTATATTTTTTAAGCATTCATCACACAACCGAAACATTTAAATGAGTATTTCTTTATTTTAGGCATGTCTTGAAGACATCAGGCGTTCTCTGGAGGCCGGTTACCCAAGCCACCTGCAGGACAAACTACAAACTAGACAAACCGCCTGCCAGAATCAGCTAAGAAAAGCTGAAAAACCCAACATACCACACACAGATCATCAATTATCACCATGCCAGAAGACTGTAAACTCTACTGGTCATCTTTCAGATGGTGTATCTGTTTATTTCAGCTCGGACAAAGGTCGCCACATGTTAGTCATGGAGAATAAACCAGCTGGAGAAGTGGTGCTGGAAGATGAAGCTTACTGTTCTGTCCTTATACCAGCTAACATATTTAATACAGGAACCAATAAGGCGGTAGAGACATTTGGTACTGAAGAT[C/T]GACATTGTCACCACTGCCTCAGCCAGTCACTGAGTTTTGTGCCCTGTCCAAAGTGTAGTTACGCTCGATATTGTGGAGAGAGCTGTCAGAAAGATGCATGGGATCAATGGCACCAGTGGGAATGTCCAGTTGGAGCTGATCTGCTGGCCATTGGGGTTTTGGGACATTTAGCACTAAGAGTGGTCCTTAAAGCAGGACAAACTGAAGTCCAAATGGGGATTAAAAACACAAAAGACCATGTGACCACTTATAAAAATGATTCACCAGTCCAGTTGAGTCTCGGAGGGGACTGTGGAAAAAGTTTAGACCATACAGACTGTTTTCATGGCAGCTCATACATGGGCATCTATAGCCTTTTACCGCATGTGGCACAACACTCACCTGCTTCACGCTTCTTAATGGCCATCACCATGGCGGTGATTTACGGGAAGCTTCAAGGCGGACCTCCACCAAACAAGTGGATGTCCTTCAAAGACGAAGGAGTTAAAGCAAGCTGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9406
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086490 Nonsense 490 753 5 10
Genomic Location (Zv9):
Chromosome 10 (position 37277977)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36154223
GRCz11 10 36097981
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACAAGCATCTCCTTYACTACAGGATTTCAGCCTGACCCACATAATCAGT[T/A]GGGCTGTTCTGAAGGTCACTTTGACCATCCCAAGGGCTCTCGGWCTGGTG
Long Flanking Sequence:
AGGGCATCTGCTGTGTAAAACATATGCTGGATATTTCACTGTGGATTATTTCACTGTGGCCATGATTAAGTAGCCAAAAGAAAGTTGTAAAGCGTTGTAAAGTTATGCAATATACTTTTTCTCTGATCGCCTTATATTTTACTTCCAGGATACCCAGAAGTCCTTAAACTCATTCAGGACATAGGGCTAGGGCTTCCCATATTGTAATTCATCAAAAACACGGATTGTCGTTAAAAAAAAAAAAAAAAATCACCAGTGGCAGGGAAGCATTGTCTTTTAATTGACAAAATAGTCAATAGTGGAGAAAGAGCTAATATATTTGATTATTAAATTTGTTTTCTCATTTCTTGCAGAAGAAAGTGGCATGGCTGTTCAGTCCAGCAGTGAAATCCGTATTGCCACAGCTATATTCCCTGTGCTCAGCCTGCTTAACCACTCCTGCAGTCCAAACACAAGCATCTCCTTCACTACAGGATTTCAGCCTGACCCACATAATCAGT[T/A]GGGCTGTTCTGAAGGTCACTTTGACCATCCCAAGGGCTCTCGGTCTGGTGTGACGGTCACTGTACGTGCTTCAAAAGACCTCACTGCAGGACAGGAGATTCTGCACTGTTATGGTATTGTGTGATCATGGAAATTTTGATTTAGTTTTGATGGAGGCTCATGTAGGTTTGCTTTTATAATGTCATTATTTCATCACAGGCCCTCACCGTAGCAGAATGGAGGTGAAGGAGCGTCAGCGCCTCCTGCTGGAGCAGTACTTTTTCCAGTGTGTATGTCAGGCCTGTCAGAGAGATCTGTCAGAAGGAAGCCCGAATGCAAAAGAACACACAGCACCAGGGATGAAGTGTGTGAAATGTGGAAAGCCTCTTCAGGTAAACATTTTCAGAAAGGTCTAACTCAGGGGTGCCCAAACTTTTTCATGTGAAGGGCCAAAAACCAAATATCATTGAGAGCTGTAAGCCGAAGGTAAATATATCAAACTATTACATTAAAGTTGTCAT
Associated Phenotype:
Not determined