Busch Lab

ZMP

si:ch211-180b7.2

Ensembl ID:
ENSDARG00000060980
ZFIN ID:
ZDB-GENE-091116-14
Human Orthologue:
ATP8B1
Human Description:
ATPase, aminophospholipid transporter, class I, type 8B, member 1 [Source:HGNC Symbol;Acc:3706]
Mouse Orthologue:
Atp8b1
Mouse Description:
ATPase, class I, type 8B, member 1 Gene [Source:MGI Symbol;Acc:MGI:1859665]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa23846 Essential Splice Site Available for shipment Available now
sa9801 Nonsense Available for shipment Available now
sa37211 Nonsense Mutation detected in F1 DNA Not yet available
sa37210 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23845 Nonsense Available for shipment Available now
sa14588 Nonsense Available for shipment Available now
sa37209 Essential Splice Site Available for shipment Available now
sa43566 Nonsense Mutation detected in F1 DNA Not yet available
sa23844 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23846
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086492 Essential Splice Site 87 1131 2 25
ENSDART00000137844 Essential Splice Site 87 847 3 22
Genomic Location (Zv9):
Chromosome 21 (position 3919097)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3516353
GRCz11 21 3667774
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGTTTCAGAAGAAGGTCTTTCTGTGCATCAAGAAAAGCAGATACTCTG[T/A]AAGTGAATCCATCATTGTTTACAGTGAAACTCCAATCACCCATATCGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9801
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086492 Nonsense 94 1131 3 25
ENSDART00000137844 Nonsense 94 847 4 22
Genomic Location (Zv9):
Chromosome 21 (position 3913013)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3510269
GRCz11 21 3661690
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTATAATTTTGRATGTCTTTTKATTTRTAGGGAAACGCAATCAAGACCTA[C/A]AAATACAATGTGTTAACCTTCCTGCCGCTGAATCTGTATGAGCAGTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37211
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086492 Nonsense 399 1131 11 25
ENSDART00000137844 Nonsense 398 847 12 22
Genomic Location (Zv9):
Chromosome 21 (position 3903751)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3501007
GRCz11 21 3652428
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTGGGGCTACATCATCATCCTCAACACCATGGTGCCCATCTCGCTTTA[C/A]GTCAGGTATAGTTATGGATGCTTCATTTACATCTGATGCTTTGAAATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37210
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086492 Essential Splice Site 401 1131 11 25
ENSDART00000137844 Essential Splice Site 400 847 12 22
Genomic Location (Zv9):
Chromosome 21 (position 3903745)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3501001
GRCz11 21 3652422
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTACATCATCATCCTCAACACCATGGTGCCCATCTCGCTTTACGTCAG[G/T]TATAGTTATGGATGCTTCATTTACATCTGATGCTTTGAAATAGTTGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23845
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086492 Nonsense 438 1131 12 25
ENSDART00000137844 Nonsense 437 847 13 22
Genomic Location (Zv9):
Chromosome 21 (position 3901600)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3498856
GRCz11 21 3650277
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGCTGATAAAGACACTCCGGCCAAATCCAGAACCACCACCCTGAACGAG[C/T]AGCTGGGCCAGATCGAGTACATCTTCTCGGATAAAACCGGCACGCTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14588
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086492 Nonsense 566 1131 15 25
ENSDART00000137844 Nonsense 565 847 16 22
Genomic Location (Zv9):
Chromosome 21 (position 3894086)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3491342
GRCz11 21 3642763
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGGCGCTCTGGTCAYAGCAGCACGAAAYTTCGGMTTTGTCTTCCTGTCG[C/T]GAACWCAAGAYACCATCACCATCCAGGAGATGGACAAACCACAGACCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37209
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086492 Essential Splice Site 756 1131 19 25
ENSDART00000137844 Essential Splice Site 755 847 20 22
Genomic Location (Zv9):
Chromosome 21 (position 3889694)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3486950
GRCz11 21 3638371
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCAGCTGCTGACAGACGACATGAAGATCCACTATGGAGAAGACGTCAA[G/A]TATGATTCATTCATTTATTCATTCCCCGTTCATTCATCTATATATTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43566
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086492 Nonsense 856 1131 21 25
ENSDART00000137844 Nonsense 804 847 22 22
Genomic Location (Zv9):
Chromosome 21 (position 3887527)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3484783
GRCz11 21 3636204
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGAGAAGGAGAAGCGGCAGGAGGATTTCGTGGATATGGCCTGTGAATG[C/A]AGCGCCGTCATCTGCTGCCGCGTCACGCCCAAGCAGAAGGCCAACGTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23844
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086492 Nonsense 984 1131 23 25
ENSDART00000137844 None None 847 None 22
Genomic Location (Zv9):
Chromosome 21 (position 3880408)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3477664
GRCz11 21 3629085
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTGTTGTTGTGTTTCAGACAGCGTATGAAGACTGGTTCATCACTCTATA[T/G]AACGTCTGCTACAGCAGTTTACCGGTTCTCCTCGTCGGCCTTCTGGATCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa894
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086492 Essential Splice Site 1001 1131 23 25
ENSDART00000137844 None None 847 None 22
Genomic Location (Zv9):
Chromosome 21 (position 3880355)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3477611
GRCz11 21 3629032
KASP Assay ID:
554-0801.1 (used for ordering genotyping assays)
KASP Sequence:
CGTCTGCTAYAGCAGTTTACCGGTTCTCCTCGTCGGCCTTCTGGATCAGG[T/A]ATCATTAACACACANNNNNNNNNNATAACAATATAGTAATATTATCTTCTCCCATAATAA
Associated Phenotype:
Not determined