Busch Lab

ZMP

dync1i1

Ensembl ID:
ENSDARG00000060948
ZFIN ID:
ZDB-GENE-061215-62
Description:
cytoplasmic dynein 1 intermediate chain 1 [Source:RefSeq peptide;Acc:NP_001073459]
Human Orthologue:
DYNC1I1
Human Description:
dynein, cytoplasmic 1, intermediate chain 1 [Source:HGNC Symbol;Acc:2963]
Mouse Orthologue:
Dync1i1
Mouse Description:
dynein cytoplasmic 1 intermediate chain 1 Gene [Source:MGI Symbol;Acc:MGI:107743]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28659
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086409 Essential Splice Site 591 627 16 17
Genomic Location (Zv9):
Chromosome 16 (position 27573717)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25419404
GRCz11 16 25334436
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCGGTGGGGGATTCAGAGGGTCGTGTTTGGATCTATGACGTGGGAGAGG[T/G]AATAATACCTGCTGTACATTGTGAACATTATGCTGCAGCTGTATGATTAA
Long Flanking Sequence:
TGAATTTCCATGATCCACGATGATCCTTTTAAGGAGATCATTCTTCTAATATGCTGATTCGGTACATGAAAAAACTCTTGAATATGCTTGAATTGTACATCTAGTTTATGGAATCAGTTAATAATAACAACTTAATGAAAATATATTAGATATACCATTAGATGTAGATATAAAATATTCACATGAAAAGTCAGAATTAATAGCAATACAGTAATAACATCACCATTCAATAAATGTGCTAAAATAAGTAACACCTATTGTCTAGAAAAAATAAAAGATGTGAAAGAAGGCCTCTTATCTTAATATGTTTCCAAATTGCCCTTACTTGATAATAAATGTGTGCTCGATCTGAATTAATTCATGTGTCCACCAGGTGCCTTCAGCCAGTGTAAGCGTGGAGGGAGGATGTGCCCTGAATCGGGTCAGATGGGCATCAGGTGGCAGAGAGGTGGCGGTGGGGGATTCAGAGGGTCGTGTTTGGATCTATGACGTGGGAGAGG[T/G]AATAATACCTGCTGTACATTGTGAACATTATGCTGCAGCTGTATGATTAATTGTTTGGGATCTTGATTCTAATGCCGGTGTAGCCTAAAGAATGATTCAGCTTCTTAACTCTTAAAAAAGTACGATCACAGCTGACATTCAGATCTGTGTTTGAGCCAGAGAAAGCAGATGTCTTGAGTAGCTGTGACCCATCATCTGTTTTTTCAACCAAAATGTTGATTCTGCATTACAAAATGTCAGATTATCACAGAAGTACTGAGATAAACATATTATACAGTAGTTTGGAAACAAACATGTCTATACTAGCAAAAACTGGATTGAAAGTAGAAACCAATGACTGTAGAAACTAACAAAATGTAGACTTATATTATCTGAATTGAAAGATTAAAAATAGCAAAGGGAATAAATAAAAAAATTAATAAATACTGGAAGAAAGACTATAGATTGGAATTGCCATATCAAGTTGGAATTCTAGGAAACAGATGTTTATTTTATTTTAT
Associated Phenotype:
Not determined