Busch Lab

ZMP

adnp2a

Ensembl ID:
ENSDARG00000060937
ZFIN ID:
ZDB-GENE-040914-55
Description:
ADNP homeobox 2a [Source:RefSeq peptide;Acc:NP_001091735]
Human Orthologue:
ADNP2
Human Description:
ADNP homeobox 2 [Source:HGNC Symbol;Acc:23803]
Mouse Orthologue:
Adnp2
Mouse Description:
ADNP homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2448562]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa36136 Nonsense Available for shipment Available now
sa22842 Nonsense Available for shipment Available now
sa15006 Nonsense Available for shipment Available now
sa22841 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36136
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086375 Nonsense 138 962 4 4
Genomic Location (Zv9):
Chromosome 16 (position 27616046)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25461733
GRCz11 16 25376765
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACAGAACAACACATTCAGTTTTTCCACATGCTGCCATCAAGAGCCCAT[C/T]AGAGCCACCCTAGCCACACTTTGGCCCACACACCGAAAACCATATCAGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2880
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086375 Nonsense 177 962 4 4
Genomic Location (Zv9):
Chromosome 16 (position 27615928)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25461615
GRCz11 16 25376647
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCTGACGACAGATACACTTGCGCGACCTGTGGTTATCATGACTCTTTAT[T/A]GTATGTGATGAAGAAGCACGTCCTGGTAAACCACTTTGCTACGTTGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22842
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086375 Nonsense 429 962 4 4
Genomic Location (Zv9):
Chromosome 16 (position 27615173)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25460860
GRCz11 16 25375892
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATGGGTGTACGTTCACCATTTCTTGTTACTCAAGGTCTTCAGCTGAAC[C/T]AGTCGGTTCCAAGAGCTCCCCTCATCACCTCGCAGTCTGTGCGTCTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15006
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086375 Nonsense 519 962 4 4
Genomic Location (Zv9):
Chromosome 16 (position 27614902)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25460589
GRCz11 16 25375621
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATGAATAAAAATTCCAGAYCAAATGAACTTGCTGTGCAGGCGCCRTTTT[T/A]RAAAAAACAKGATAAKCAAACTGTCAAGTGCCTGAGGTGCAAGATTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22841
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086375 Nonsense 846 962 4 4
Genomic Location (Zv9):
Chromosome 16 (position 27613922)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25459609
GRCz11 16 25374641
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCCCGTTTGTGGATAAACAAGGCGGACGTGAAGGCGCACTTCAACAGC[A/T]AGCTCACTAAGTGCTTGAAAGCGATTCAGAAAAAGAGGGTTTGCGTACGT
Associated Phenotype:
Not determined