Busch Lab

ZMP

zgc:153254

Ensembl ID:
ENSDARG00000060929
ZFIN ID:
ZDB-GENE-060929-1006
Description:
hypothetical protein LOC561654 [Source:RefSeq peptide;Acc:NP_001070038]
Human Orthologue:
RNF220
Human Description:
ring finger protein 220 [Source:HGNC Symbol;Acc:25552]
Mouse Orthologue:
Rnf220
Mouse Description:
ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa19803 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3424
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086340 None None 307 None 11
ENSDART00000134651 Nonsense 138 577 1 14
ENSDART00000136330 None None 197 None 8
ENSDART00000139295 None None 232 None 9
ENSDART00000143879 None None 70 None 7
ENSDART00000145588 None None 139 None 5
Genomic Location (Zv9):
Chromosome 2 (position 32770646)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33069553
GRCz11 2 33052771
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCCATTCGCTTCTCCTCCGGAAGATCGKGATGGAGCGGGTGGTGGATAC[C/T]AGTCTGCATTCACCCCTGCCAAGAGGCTAAAGGGCTGCCTGGAGGCCGAG
Long Flanking Sequence:
CCCCGTCTCTCTTCTCTCCACCCCTCCCCCACACCCCTCTACTCTCACCCCTCACCCCCCCTCCACCCAACCCCAGCCCAATCTCCAAAATGGACTTGCATCGGGCGGCTTTCAAAATGGAGAGCTCCTCCTACCTACCCAACCCGTTAGCATCCCCTGCACTAATGGTGCTAGCATCGACGGCTGAGGCTAGCCGTGATGCCTCCATCCCCTGCCAACAGCCTCGGCCATTCGGTGTGCCAGTGTCTGTGGAGAAGGACGTTCACCTGCCCTTCAACAATGGTTCCTATACGTTTGCCTCCATGTACCACCGACAGGGCGCCGTACCACCAGGCTTCCCCAACAGGGACTTTCCTCCTTCCCTTCTACACCTCCATCATCAGTTTGCACCACCCAATCTGGACTGCTCCCCCATAAGCATGCTCAACCACAGTGGTGTCGGGGCCTTCCGGCCATTCGCTTCTCCTCCGGAAGATCGTGATGGAGCGGGTGGTGGATAC[C/T]AGTCTGCATTCACCCCTGCCAAGAGGCTAAAGGGCTGCCTGGAGGCCGAGGCGTCCCCGCACTTGCGCTACTCAGACGCAGAAGGGAAAGAATATGACTTTGGTGGTGCTCAGATCCCATCCAGCTCACCCAGTGCTCTCAAAGCTGTGGAAGATGCAGGGAAGAAGATCTTCGCAGTGTCAGGCCTGCTGTCAGATCGAGAAACCTCTTCCAGCCCAGAGGATCGCATTGAGCGCTGTGAGTACCTTTTTTTTTTAAATTGAAAAGCACTGTTAATGCTTGCCAAACTGTAGGCTTTTAAATAACTTCTCTCTCCTTAAAGGGATAGTTCACCCAAAAATGATAATTTACTAACCCTCAAGTAGGTTCCAAAAGCAGTTGTTAGAAATAGCCATGTCAATAAACGCTTTTTAATATTTTTTTAGCATTTTTGAGTGCTTTGGATTGATTCTCTGATGAATCTTTTATGCAAAGAGCATCAACACATTATTTAGGCTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19803
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086340 Missense 42 307 3 11
ENSDART00000134651 Essential Splice Site 337 577 None 14
ENSDART00000136330 Essential Splice Site 76 197 None 8
ENSDART00000139295 Essential Splice Site 40 232 None 9
ENSDART00000143879 Missense 42 70 3 7
ENSDART00000145588 Missense 77 139 4 5
Genomic Location (Zv9):
Chromosome 2 (position 32911694)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33210601
GRCz11 2 33193819
KASP Assay ID:
2259-2246.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGCCCGGATTGGGAAAATGAAGCGCCGGAAGCCTGAGGATGGACAGG[T/C]ATGTCCACTGTGCAGCGCCCCGCTGGCAGGGACAGAGGAGGAAATGAGTA
Long Flanking Sequence:
TCACTGTCGTGTTTTGTGACCCATCTTTCTTGCTTCTGTAAAATCCATGGTTAGAGACGCCTACTGGCCTTAAGCTAAATCTGTAAAGGATTCTGATACATGTGGGATGTTTTATGTGGGATTTATATTGCTTCATCTTTTAGAATGCTCTCTTTTAATCTTGTATCTCCTGTGATGTCCTATTTTGCCTTCATTAGCTGCTGTTGATCTCAAATTTTAGTGAAAATGAGTGTGATTAAAAATAGACAATTTTCTATTATTATTGTGTAATAATAAAATATTTAGTTTAATGTATAGTTTAATTTCATTAGTATTAAAAAGGAAAATGATTAAACATTATAATGGCCTTTGGTTTAGTGGTGCATTTATATTTATTTTATTCTCAGTGCCTATTTGTGGTGTTTATGATCACATTGATTTATCCCCTTGTGTCTGTCTTTTCTTCTGTGCTGCAGCCCGGATTGGGAAAATGAAGCGCCGGAAGCCTGAGGATGGACAGG[T/C]ATGTCCACTGTGCAGCGCCCCGCTGGCAGGGACAGAGGAGGAAATGAGTAGGCATGTGGAACAATGTCTGTTCAAGGTAGCTTCATGAACCCAGAGATCTGGGAATCCAACCTCCTCTAGAAAGTTTGGCCTTTCTGCCCTCACCTTTCCCTGGACATCAGCATCTGACAGACATCAGCATCTGACAAAGCATACACACATACATACAGTATGCAAAAAAATCTCCTTGATTTACTACAACTATGTTCTCCTACATGGGTGTCCAGGGAACAGTTGAAGGATTAGCTCTTTCCTAAAGTTTCCTCCTCCTCCTGCACTTTAGCACATTTGTTTGGCAGTTTCGGTGTCCTGAACCAACTTCAAAGATGTTCTGCATTATTGTCCTTTGGTAATGAGTTCAAAAAGAAAACTGTTGTTCAAACAGTCTGACTGGCTTCCCATTTTAGTGGTTCAGGATGCAGCACTTGCCCATTATATTATGTAGCAGGTTCCTCTTAACC
Associated Phenotype:
Not determined