Busch Lab

ZMP

si:rp71-45k5.9

Ensembl ID:
ENSDARG00000060926
ZFIN ID:
ZDB-GENE-060503-281
Description:
E3 ubiquitin-protein ligase RNF19B [Source:UniProtKB/Swiss-Prot;Acc:Q1L8L6]
Human Orthologue:
RNF19B
Human Description:
ring finger protein 19B [Source:HGNC Symbol;Acc:26886]
Mouse Orthologue:
Rnf19b
Mouse Description:
ring finger protein 19B Gene [Source:MGI Symbol;Acc:MGI:1922484]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23567 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23567
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086349 Nonsense 58 701 1 10
ENSDART00000148080 Nonsense 59 702 1 9
Genomic Location (Zv9):
Chromosome 19 (position 36949005)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35813525
GRCz11 19 35400645
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACGTGGGCCTAGGGGGAGCAAGGCTAATGTGGGCACTCCTCTCGCTCAA[C/T]AGCTGCACCAACAGCAGCAAATCCAGCAGCAGCAGCTTCTGCAGCCCCCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4818
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086349 Essential Splice Site 408 701 5 10
ENSDART00000148080 Essential Splice Site 409 702 5 9
Genomic Location (Zv9):
Chromosome 19 (position 36934594)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35799114
GRCz11 19 35386234
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGGCGCTGTCGATCATCACAGCTCCAGTCATCGCTGCTGTCAGTGTGGG[T/C]GAGTATTTYTCAGGGAAATAACATATTTGCACTAGAGGCTCAGWAGGATT
Associated Phenotype:
Not determined