Busch Lab

ZMP

dgcr14

Ensembl ID:
ENSDARG00000060922
ZFIN ID:
ZDB-GENE-030131-2843
Description:
protein DGCR14 [Source:RefSeq peptide;Acc:NP_001082799]
Human Orthologue:
DGCR14
Human Description:
DiGeorge syndrome critical region gene 14 [Source:HGNC Symbol;Acc:16817]
Mouse Orthologue:
Dgcr14
Mouse Description:
DiGeorge syndrome critical region gene 14 Gene [Source:MGI Symbol;Acc:MGI:107854]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38812 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38812
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086335 Nonsense 211 469 5 11
ENSDART00000132976 Nonsense 211 469 5 10
Genomic Location (Zv9):
Chromosome 10 (position 43466643)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42273138
GRCz11 10 42101518
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTCGGAGAAACAGGCTCTGGAGTGCACCAAAGCAGGACTGGAAACATG[G/A]CAGTACAAGGCCAAAAATTCACTGATGTATTATCCTGAAGGTAAAGCCTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27678
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086335 Nonsense 400 469 10 11
ENSDART00000132976 Nonsense 400 469 10 10
Genomic Location (Zv9):
Chromosome 10 (position 43455432)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42261927
GRCz11 10 42090307
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGAGCCCCGCAGCCCTGTCTCCTGCTCTCCAGCGTCTGGTAAACAGAT[C/A]GTCCAGCAAATACACAGATAAAGCGCTGCGGGCGAGCTACACGCCGTCTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1062
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086335 Nonsense 413 469 10 11
ENSDART00000132976 Nonsense 413 469 10 10
Genomic Location (Zv9):
Chromosome 10 (position 43455392)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42261887
GRCz11 10 42090267
KASP Assay ID:
554-0965.1 (used for ordering genotyping assays)
KASP Sequence:
GTRAACAGATCGTCCAGCAAATACACAGATAAAGCGCTGCGGGCGAGCTA[C/A]ACGCCGTCTCCTGCGCACAGAAGCCTCGGCGCCAAAACTCCATCYGGAGG
Associated Phenotype:
Not determined