Busch Lab

ZMP

pla2g6

Ensembl ID:
ENSDARG00000060921
ZFIN ID:
ZDB-GENE-040426-2079
Description:
85 kDa calcium-independent phospholipase A2 [Source:RefSeq peptide;Acc:NP_998262]
Human Orthologue:
PLA2G6
Human Description:
phospholipase A2, group VI (cytosolic, calcium-independent) [Source:HGNC Symbol;Acc:9039]
Mouse Orthologue:
Pla2g6
Mouse Description:
phospholipase A2, group VI Gene [Source:MGI Symbol;Acc:MGI:1859152]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa29818 Nonsense Mutation detected in F1 DNA Not yet available
sa43871 Nonsense Mutation detected in F1 DNA Not yet available
sa3189 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa29818
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044559 Nonsense 316 818 6 17
ENSDART00000086336 Nonsense 319 757 6 15
Genomic Location (Zv9):
Chromosome 22 (position 31668980)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29148058
GRCz11 22 29097253
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCGTCTTCTGCTGGACAGAGGATGCAACGTCAACTACTTGAGCAAGACT[G/T]GAGAAAGTCCTTTACACATCCTGACCAAGAGAGGGCGCTTTGAGGCCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43871
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044559 Nonsense 406 818 8 17
ENSDART00000086336 None None 757 None 15
Genomic Location (Zv9):
Chromosome 22 (position 31679149)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29158227
GRCz11 22 29107422
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCACTCCGACTGAAGGCTCCAACCGTAAGGTGCTGTTGAACATGCTGTG[T/A]AGTGTAGGTGTCGAACGCTGCCATCCTCCATCCCTCAACAGCCCTACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3189
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044559 Nonsense 589 818 12 17
ENSDART00000086336 Nonsense 553 757 11 15
Genomic Location (Zv9):
Chromosome 22 (position 31690421)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29169499
GRCz11 22 29118694
KASP Assay ID:
554-3303.1 (used for ordering genotyping assays)
KASP Sequence:
AGCGTTCTTGCAGACAGACACCCTGGAGAACTGCATCTGTTTCGCAATTA[C/A]GACCCGCCGGCCCTTCAGAGAGACCCTCCATACAAGTCTACRGCCACATT
Associated Phenotype:
Not determined