Busch Lab

ZMP

si:ch211-126i22.5

Ensembl ID:
ENSDARG00000060911
ZFIN ID:
ZDB-GENE-091204-183
Human Orthologue:
KIAA1958
Human Description:
KIAA1958 [Source:HGNC Symbol;Acc:23427]
Mouse Orthologue:
E130308A19Rik
Mouse Description:
RIKEN cDNA E130308A19 gene Gene [Source:MGI Symbol;Acc:MGI:2442164]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa31767 Nonsense Available for shipment Available now
sa41601 Nonsense Mutation detected in F1 DNA Not yet available
sa31768 Nonsense Available for shipment Available now
sa8533 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31767
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086269 None None 652 None 12
ENSDART00000135355 Nonsense 328 883 2 7
ENSDART00000143615 Nonsense 226 266 1 3
ENSDART00000145673 None None 131 None 2
Genomic Location (Zv9):
Chromosome 10 (position 11253495)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11329361
GRCz11 10 11287599
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGGAGAGGCTTCGATTGGCGCAAACCCAGAAATGGATCTTCTATCTGCA[C/T]AGGCACTTAGTACAGAAGCGAGAGCAGACAACACAGGTAAAGAGCCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41601
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086269 Nonsense 318 652 12 12
ENSDART00000135355 Nonsense 549 883 7 7
ENSDART00000143615 None None 266 None 3
ENSDART00000145673 None None 131 None 2
Genomic Location (Zv9):
Chromosome 10 (position 11277231)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11353097
GRCz11 10 11311335
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTCCCTTCTTCCCTTTCAGCAGACATGGATGAGAGAGCGTATCCAGAA[C/T]AGAACGAGAAGACGATTCGCAGCACCCAAACAGCTCTCCGCAACTTTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31768
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086269 Nonsense 344 652 12 12
ENSDART00000135355 Nonsense 575 883 7 7
ENSDART00000143615 None None 266 None 3
ENSDART00000145673 None None 131 None 2
Genomic Location (Zv9):
Chromosome 10 (position 11277309)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11353175
GRCz11 10 11311413
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACAGCTCTCCGCAACTTTCGGGATTTCCTGGTTTCAAAGTATCCAAAC[G/T]AGACCAGAGAAATTTACAACATCCCCTGCCACGAGTTAGACATCTACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8533
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086269 Nonsense 405 652 12 12
ENSDART00000135355 Nonsense 636 883 7 7
ENSDART00000143615 None None 266 None 3
ENSDART00000145673 None None 131 None 2
Genomic Location (Zv9):
Chromosome 10 (position 11277492)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11353358
GRCz11 10 11311596
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACGCTATCTGAAGGAGCATCGGTATGCCTACAGTWTTACAAGAGACCGC[G/T]AGTTCCAGAGATCCCAGGATGCCCTCAAGCAAAAGCAACTGGAGCTCAAG
Associated Phenotype:
Not determined