Busch Lab

ZMP

si:ch211-276k2.5

Ensembl ID:
ENSDARG00000060884
ZFIN ID:
ZDB-GENE-081104-220
Human Orthologue:
NMUR1
Human Description:
neuromedin U receptor 1 [Source:HGNC Symbol;Acc:4518]
Mouse Orthologue:
Nmur1
Mouse Description:
neuromedin U receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1341898]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa11726 Nonsense Available for shipment Available now
sa12218 Nonsense Available for shipment Available now
sa15050 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11726
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086243 Nonsense 64 395 1 2
ENSDART00000131469 Nonsense 54 360 1 2
Genomic Location (Zv9):
Chromosome 22 (position 38365040)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35513461
GRCz11 22 35489210
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCATWGTCATYGCTAAAAACAAAGTCATGMGGACGCCGACCAACTTCTA[C/A]CTGTTCAGCCTGGCCATTTCAGATCTTCTAGTGCTTCTCCTGGGAATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12218
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086243 Nonsense 220 395 1 2
ENSDART00000131469 Nonsense 210 360 1 2
Genomic Location (Zv9):
Chromosome 22 (position 38364572)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35512993
GRCz11 22 35488742
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGASTCTGCTATTCTTCCTGTTGCCCATGTTGACCATMAGCGTTTTGTA[T/A]CTGCTCATCGGCATGCAGCTGAAGCGGGAGAAGATGCTGCAGGTCCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15050
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086243 Essential Splice Site 267 395 None 2
ENSDART00000131469 Essential Splice Site 257 360 None 2
Genomic Location (Zv9):
Chromosome 22 (position 38364431)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35512852
GRCz11 22 35488601
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCAGTCAGCAGCAGAAAAYCCGTCRCCAGCAGGTGACCAAGATGTTGTG[T/C]AAGTAGGCCGACTGTTACACWCTGGCAGACTGCTTTGAATCAYATTACAC
Associated Phenotype:
Not determined