Busch Lab

ZMP

edil3b

Ensembl ID:
ENSDARG00000060877
ZFIN ID:
ZDB-GENE-090312-42
Human Orthologues:
EDIL3, F8
Human Descriptions:
EGF-like repeats and discoidin I-like domains 3 [Source:HGNC Symbol;Acc:3173]
coagulation factor VIII, procoagulant component [Source:HGNC Symbol;Acc:3546]
Mouse Orthologue:
Edil3
Mouse Description:
EGF-like repeats and discoidin I-like domains 3 Gene [Source:MGI Symbol;Acc:MGI:1329025]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa15447 Nonsense Available for shipment Available now
sa658 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa15447
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086227 Nonsense 77 475 3 10
ENSDART00000142872 Nonsense 4 385 1 8
Genomic Location (Zv9):
Chromosome 10 (position 44870290)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43563878
GRCz11 10 43392258
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTRGWTCTGAGATCNNNNTTTTTGTGCTTCAGGGCCCWGCCGGCCRAACCCGTG[T/A]CACARTGGAGGCCTGTGTGARCTTAATCAGACCGACCGCGGAGACRCYTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4395
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086227 Nonsense 111 475 3 10
ENSDART00000142872 Nonsense 38 385 1 8
Genomic Location (Zv9):
Chromosome 10 (position 44870190)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43563778
GRCz11 10 43392158
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACTGGGATATTTGTGCAGGTGTCCGGCTGGATTCAACGGGGTTCACTGC[C/T]AACACAGTAAGAAACCTTTTTACWCACATTTTTACGCACAATTTTAGAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27681
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086227 Essential Splice Site 151 475 5 10
ENSDART00000142872 Essential Splice Site 78 385 3 8
Genomic Location (Zv9):
Chromosome 10 (position 44857401)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43550989
GRCz11 10 43379369
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGAATTAAGAATACAACGGTTGCTTACACTTTCTTGCTGTGTTCTGGC[A/T]GAATGTTCCGGGCCTTTAGGGATGGAAGGAGGAATCATCTCGAACCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa658
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086227 Nonsense 475 475 10 10
ENSDART00000142872 None 386 385 8 8
Genomic Location (Zv9):
Chromosome 10 (position 44833932)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43527520
GRCz11 10 43355900
KASP Assay ID:
554-0566.1 (used for ordering genotyping assays)
KASP Sequence:
GGTATGGACGGATCACCGTACGGATGGAGCTGCTGGGATGTCCGGAGGAA[C/T]AGTGAAAAACATTTCTAACGCTGATCTCNNAAGGATGCTGACTCAAAAGCGG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461