Busch Lab

ZMP

si:ch73-169d9.1

Ensembl ID:
ENSDARG00000060875
ZFIN IDs:
ZDB-GENE-090831-2, ZDB-GENE-100922-7
Human Orthologue:
PDE1A
Human Description:
phosphodiesterase 1A, calmodulin-dependent [Source:HGNC Symbol;Acc:8774]
Mouse Orthologue:
Pde1a
Mouse Description:
phosphodiesterase 1A, calmodulin-dependent Gene [Source:MGI Symbol;Acc:MGI:1201792]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa17187 Nonsense Available for shipment Available now
sa34755 Nonsense Mutation detected in F1 DNA Not yet available
sa21590 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17187
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086202 Nonsense 27 611 1 15
ENSDART00000140689 None None 139 None 4
Genomic Location (Zv9):
Chromosome 9 (position 45709273)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44840938
GRCz11 9 44641890
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGGAGAACTCTCTCAAGTACTCCAAGTGTGATCAGACGGAGAAGATGTG[G/A]ATTAGGCTGAAAGGAATGTAAGTGTTTTCTTATTTTTTTTTTTGTTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34755
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086202 Nonsense 154 611 5 15
ENSDART00000140689 Nonsense 130 139 4 4
Genomic Location (Zv9):
Chromosome 9 (position 45601729)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44733394
GRCz11 9 44534346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCTTTGCAGAATGTACAGAAGAACATCCAACATGGCAGGGTTGACCTA[T/A]CCGCCATCTGTAATTACTGCTCTAAAGGTACAGATTATCTTCGCAGTACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5567
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086202 Nonsense 346 611 10 15
ENSDART00000140689 None None 139 None 4
Genomic Location (Zv9):
Chromosome 9 (position 45582230)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44713986
GRCz11 9 44515728
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCTGGTCATCGAGATGGTCATGAGCACTGATATGTCCTGCCATTTCCAG[C/T]AGATCAAGACCATGAGGAACKCTCTGCAGCAGCCTGAGGGGTGAGTSACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21590
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086202 Nonsense 606 611 15 15
ENSDART00000140689 None None 139 None 4
Genomic Location (Zv9):
Chromosome 9 (position 45564702)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44696458
GRCz11 9 44498200
KASP Assay ID:
2260-2462.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGCCGGAGATGCTTCCCCGGAGGAGCACAGCTCAGAAACGCTGCCCTG[G/A]AACGGCAAGAGCGCCTGAATCTTTGCAGTCACAAATGGGACGATGTACAT
Associated Phenotype:
Not determined