Busch Lab

ZMP

dars2

Ensembl ID:
ENSDARG00000060861
ZFIN ID:
ZDB-GENE-070912-443
Human Orthologue:
DARS2
Human Description:
aspartyl-tRNA synthetase 2, mitochondrial [Source:HGNC Symbol;Acc:25538]
Mouse Orthologue:
Dars2
Mouse Description:
aspartyl-tRNA synthetase 2 (mitochondrial) Gene [Source:MGI Symbol;Acc:MGI:2442510]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa25851 Nonsense Mutation detected in F1 DNA Not yet available
sa25113 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3418
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086197 Nonsense 328 639 12 19
ENSDART00000137170 Nonsense 349 397 10 11
ENSDART00000148351 None None 191 None 4
Genomic Location (Zv9):
Chromosome 2 (position 33870831)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 34169738
GRCz11 2 34152956
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTAATGTCCCCTTTCCCACCCTGACTTATGAAGAAGCCATGAGAGACTA[C/A]GGAGTTGACAAACCAGACACTAGATTTGGGATGAAGGTGACCGCTTGNTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25851
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086197 Nonsense 424 639 15 19
ENSDART00000137170 None None 397 None 11
ENSDART00000148351 None None 191 None 4
Genomic Location (Zv9):
Chromosome 2 (position 33878941)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 34177848
GRCz11 2 34161066
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGTTCACTGAAATCTCCTCTCAGCCGGCTGCTCTCGGACACGGCCAAA[C/T]AACAGCTGCTCCAGATGGCCCAGGCCAACGCTGGAGACCTGATCTTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25113
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086197 Splice Site, Nonsense 558 639 17 19
ENSDART00000137170 None None 397 None 11
ENSDART00000148351 Splice Site, Nonsense 110 191 2 4
Genomic Location (Zv9):
Chromosome 2 (position 33887771)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 34186678
GRCz11 2 34169896
KASP Assay ID:
554-7893.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGCATCCACAATGCCTCTCAGCAGCTGTACATCCTGGACACCATCCTC[A/T]AGGTAATGGAACAAGAGTGAAAAATGACAGCGCTTGTAATGGACATTTCC
Associated Phenotype:
Not determined