Busch Lab

ZMP

setd1ba

Ensembl ID:
ENSDARG00000060847
ZFIN ID:
ZDB-GENE-050309-289
Description:
Histone-lysine N-methyltransferase SETD1B-A [Source:UniProtKB/Swiss-Prot;Acc:Q1LY77]
Human Orthologue:
SETD1B
Human Description:
SET domain containing 1B [Source:HGNC Symbol;Acc:29187]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa12989 Nonsense Available for shipment Available now
sa13004 Nonsense Available for shipment Available now
sa34982 Nonsense Mutation detected in F1 DNA Not yet available
sa714 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa12989
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086165 Nonsense 22 1844 1 19
ENSDART00000086165 Nonsense 22 1844 1 19
Genomic Location (Zv9):
Chromosome 10 (position 43352037)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42158532
GRCz11 10 41986912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGAGATAGTGGTGTATTGTAAGAGACAGAAACCCCAGACTAGAGGCACA[C/T]AATATGTGTTGGCTCGCAAAAAGGAGGCAGTATCTTTAAAATCATGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13004
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086165 Nonsense 22 1844 1 19
ENSDART00000086165 Nonsense 22 1844 1 19
Genomic Location (Zv9):
Chromosome 10 (position 43352037)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42158532
GRCz11 10 41986912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGAGATAGTGGTGTATTGTAAGAGACAGAAACCCCAGACTAGAGGCACA[C/T]AATATGTGTTGGCTCGCAAAAAGGAGGCAGTATCTTTAAAATCATGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34982
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086165 Nonsense 354 1844 7 19
Genomic Location (Zv9):
Chromosome 10 (position 43360563)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42167058
GRCz11 10 41995438
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGGAGGCTACAAATCGAGGAGACATGAAACCAAATTCCAGGATGCCTA[C/A]AACCGTAGACCAGAAAGGCGATATGTCCATGGACCCACGCAACGTGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa714
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086165 Nonsense 536 1844 7 19
Genomic Location (Zv9):
Chromosome 10 (position 43361107)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42167602
GRCz11 10 41995982
KASP Assay ID:
554-0622.1 (used for ordering genotyping assays)
KASP Sequence:
GGAGCCCGATCTCCTCCTCGTCATCCCAGCTGTCCCCAATCCCACCCCAG[C/T]GACCCTCRCGGCCTTCAAGCACTGGTCTGGAGGACATCAGCCCAACTCCG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461