Busch Lab

ZMP

cabp7b

Ensembl ID:
ENSDARG00000060846
ZFIN ID:
ZDB-GENE-060526-366
Description:
Novel protein similar to vertebrate calcium binding protein 7 (CABP7) [Source:UniProtKB/TrEMBL;Acc:B
Human Orthologue:
CABP7
Human Description:
calcium binding protein 7 [Source:HGNC Symbol;Acc:20834]
Mouse Orthologue:
Cabp7
Mouse Description:
calcium binding protein 7 Gene [Source:MGI Symbol;Acc:MGI:2183437]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa2243 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5301
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086181 Essential Splice Site 36 213 1 5
Genomic Location (Zv9):
Chromosome 5 (position 33730362)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31492594
GRCz11 5 32092747
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATCCTTTCCTACAGGGCTCCCGTCAGCCTCCCCGAGGATGAAGTGGAGG[G/A]TGAGTGATATTTCATTTTGAGTTGAAGAGAGACGTTATCTTGGCGATAGC
Long Flanking Sequence:
GGACGTTGTTTTTGAGGGATGCTCTGCGTTTATCCTTCAAAGCCAGTTGAAGATGAACAGAACGCGGGGGCATTTCCAGCAGCATACGCGTACCTGTGCCACACAAGCTCCATCTGAATGGCAATACTTGAATGTGCGATTTGGTGATATCTCAAGGCAATAGTTTTCGCACCTGATGCAAGGCAATCCGCAATCGATCGAATGAATGATCATTACCGCATGAGTGTGCAGAGTGACTAATCGCATCTGGACCACAGTAATCAGGATGGAGACACGCGTTTTGATGGCTGGCTTCGGGCTTTCAGAGAGCGCTCTGTAGTAAAGTTGCAGTGGCCGGACTACAGGTGCTTTATGAAGATCAGGATAAAAGCGTCGGTTTGCCTTCGCAGAGATGCCAGTGCGTGCTGTGACTTCCAGGTTCATGTACAGGGGACTTTGCTCAATTCCAGATATCCTTTCCTACAGGGCTCCCGTCAGCCTCCCCGAGGATGAAGTGGAGG[G/A]TGAGTGATATTTCATTTTGAGTTGAAGAGAGACGTTATCTTGGCGATAGCGCTGCCAGTACTTTGTGAATGTGGGATTTCAGCACCATGGAGAGCGCCCTGCGGCAGCTTCTACTGTCCACATTCAATAAAGTGCTAGTTTTTTCACCCATGTACACACGCATTGTTAGAGTCATGACAAACGTATTACATATAGTTACAACAAAGCTAGCAATATGATAGGTGAATGATGGCTTTTAAGCCTAAAACATACATACAGACGAAAATGTATGTAGTATTTTAACACTTATTACAGTCAATGCCTCTTTCGACAAATGCACATTTAAACAAATTGATTGCCAGTTTATTAGATGCACGCATAATTTGACATATAATTTAACTATTTAAACCTTTAAACTGGTATTTTTTTCCATCCAAGTGTCCTTAGATAAATCAATGTGCAAGAACATGTACTTATTGTTCTTTTCTTTTTCATTTTATTCACAATGTTTCTCTGCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2243
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086181 Nonsense 138 213 4 5
Genomic Location (Zv9):
Chromosome 5 (position 33727514)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31489746
GRCz11 5 32089899
KASP Assay ID:
554-3203.1 (used for ordering genotyping assays)
KASP Sequence:
TAGTGTGACATGCAAAAGCTAACTGTGGACGAGCTGAAGAGACTCCTGTA[T/A]GAGACCTTCTGTGACCATTTGACTATGAAAGACATCGAGAACATCATCAT
Long Flanking Sequence:
TGGTATGCCAGACCGCTTCCACGGAGCTGAATTTGACTCCATATTCTGGAAGGTGTGGAGGTTTCCCTTGAAATGATCTCAATTATTTGGCCTTATGGTCTCTGTGATTAGTTCTGTCTGGCTTGGGCTTTACTTTGTCCCATTGTTCTGCGACTCTCTGCGATTACTGGTGGAAAAGGAGATTATTCATACATTATTCACACTCTGCAATTAACTTGCTGACATTTCTTTGGTGGTAATAGCATTGAATTAAAATTAATGTCGAAAGCGGCGCTTCAGTCCATTAGAAGGCAATATTCTCTTAAATGTGCTATTTAGTATAACTCATCTGTGCATTAGCCGCTGATCATTTATAGCAGTTATATCATCATCTGAGGGAACATTTGGCATTTTGAACATTGTTCCTTTTAACTAAAAGATCAATTTTACTCTCCTTTCTCTTTTTGGGATTAGTGTGACATGCAAAAGCTAACTGTGGACGAGCTGAAGAGACTCCTGTA[T/A]GAGACCTTCTGTGACCATTTGACTATGAAAGACATCGAGAACATCATCATGACTGAGGAGAGTCACTTAAACAGCCCGGAGTGCCAAGTAGATATTGACAGTAAGTCTTTTTTTACACCAACAATTCTCTATAGTGAAACAACAAAGCATGATAACAACAAACATGATACAGTGACCTTGGCTGTTTGTCTCCATCATATTCGTGGCCCGCGTGTGAGCCCACGCATCCGTTTCATTATGAAGTGTCTGAGCATTATCGTGTCAATCAAAATTGTCTGTCAACTCCATTAAAAACGCAAGGCACAGAGGCCATCGCTGCAGTGTAGGAAACGGCCTATTTTTAGCTGAAACATATTCTGTTGATAGTCCCGGGGAAATAAAGGAGCTCATGAATCTGTTTGAAGCAGGACAGTGGGGAGTGCATCTGCAATACTGATGAGCACTTCAACACCTCGTACTCTTTGGTAGAAAATATCTTTTTAATAAATACCAGCTGCTGG
Associated Phenotype:
Not determined