Busch Lab

ZMP

tecpr2

Ensembl ID:
ENSDARG00000060835
ZFIN ID:
ZDB-GENE-060503-358
Description:
tectonin beta-propeller repeat-containing protein 2 [Source:RefSeq peptide;Acc:NP_001038644]
Human Orthologue:
TECPR2
Human Description:
tectonin beta-propeller repeat containing 2 [Source:HGNC Symbol;Acc:19957]
Mouse Orthologue:
Tecpr2
Mouse Description:
tectonin beta-propeller repeat containing 2 Gene [Source:MGI Symbol;Acc:MGI:2144865]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa42956 Nonsense Mutation detected in F1 DNA Not yet available
sa10589 Nonsense Available for shipment Available now
sa15119 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3989
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104224 Nonsense 180 1358 4 19
ENSDART00000133668 Nonsense 180 1308 4 19
ENSDART00000133971 None None 978 None 13
Genomic Location (Zv9):
Chromosome 17 (position 29369735)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29293662
GRCz11 17 29310625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATCCAGTGGTCCTCTTCGAAGAGCCTTCAGCAATAGTACAGTTAGAATA[T/G]AGTCAAAAGGTACTTCTGGTTTCATCCTATCAACGYTCAWTGCTTTTCTA
Long Flanking Sequence:
TCAGTAATATTATTCTGTATATTATTGCATAACTTTATTTAAGGTCTGTCGAGGAAAAGCATTGATAGACTTGTCGAATTGATAATGTGGTTATGTTGTGTTGTTGCAGCTGAGAAGGTTTGATGTGGTGGGTTTGCACAAAAGCACAATTACTGCATTAGCGTGGAGTGCTAATGGCATGAAACTCTTCTCTGGTGATGATAAAGGGAAGGTGGTGTACTCTGCTGTGGACCTGGACCAAGTAAGCCTTTAATAAGGAATTGATTGGAACTGTTTCAGGCACTGCGAGAGGCAATGATGCTATAAATATTAGGATAAAAGTATTTTTGACCTTGGATGGAATTAGAAAGATTTAAGACAGGATTATAAGGTCATGTTAACAACTTTGAGTTACTGTATTATGACTGAATCTCTGAATATATGTGTACATTGTTTCTTTAGGGAGTCTGTAATCCAGTGGTCCTCTTCGAAGAGCCTTCAGCAATAGTACAGTTAGAATA[T/G]AGTCAAAAGGTACTTCTGGTTTCATCCTATCAACGCTCAATGCTTTTCTACACACAAGAGCAGTCGCATCAGCAGCTGGGCAGTAAACCACGTAAAAGGTACAGCATCTTCAGTTCATCATAACATGAAAGAGATCTATTTTCGTCAGGGTTGAACTACTGAGTTTAAGCTCCATTTTTGATATGTGTCTTCATTTTTGTAGCAATGGCAAGTTTGGAGCCTGCTTCCAGCCAGCTCTGTGCAAGCAGAGTGATCTGGTGGTTTATGCAGCGAGGCCGGGGTTACGTCTGTGGAGGACAGATGTGCGAGGACGTGTCGGGGAGACTCATGTCTTAAAGCCCCTTTTTAATCAAGATGTACCTCACTTTGAGCTGTTCCCACGCTCAGGTCCCACTGGTGGATACAGACCTTCAGAAAGACAGTTAGGAATGATCAGCTGCTTCCTGAAGGAGGGCTGGGTCCTCAGCTGGAACGAATATAGTGTTTATGTTGTGGACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42956
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104224 Nonsense 199 1358 4 19
ENSDART00000133668 Nonsense 199 1308 4 19
ENSDART00000133971 None None 978 None 13
Genomic Location (Zv9):
Chromosome 17 (position 29369680)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29293607
GRCz11 17 29310570
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAGGTACTTCTGGTTTCATCCTATCAACGCTCAATGCTTTTCTACACA[C/T]AAGAGCAGTCGCATCAGCAGCTGGGCAGTAAACCACGTAAAAGGTACAGC
Long Flanking Sequence:
AAAGCATTGATAGACTTGTCGAATTGATAATGTGGTTATGTTGTGTTGTTGCAGCTGAGAAGGTTTGATGTGGTGGGTTTGCACAAAAGCACAATTACTGCATTAGCGTGGAGTGCTAATGGCATGAAACTCTTCTCTGGTGATGATAAAGGGAAGGTGGTGTACTCTGCTGTGGACCTGGACCAAGTAAGCCTTTAATAAGGAATTGATTGGAACTGTTTCAGGCACTGCGAGAGGCAATGATGCTATAAATATTAGGATAAAAGTATTTTTGACCTTGGATGGAATTAGAAAGATTTAAGACAGGATTATAAGGTCATGTTAACAACTTTGAGTTACTGTATTATGACTGAATCTCTGAATATATGTGTACATTGTTTCTTTAGGGAGTCTGTAATCCAGTGGTCCTCTTCGAAGAGCCTTCAGCAATAGTACAGTTAGAATATAGTCAAAAGGTACTTCTGGTTTCATCCTATCAACGCTCAATGCTTTTCTACACA[C/T]AAGAGCAGTCGCATCAGCAGCTGGGCAGTAAACCACGTAAAAGGTACAGCATCTTCAGTTCATCATAACATGAAAGAGATCTATTTTCGTCAGGGTTGAACTACTGAGTTTAAGCTCCATTTTTGATATGTGTCTTCATTTTTGTAGCAATGGCAAGTTTGGAGCCTGCTTCCAGCCAGCTCTGTGCAAGCAGAGTGATCTGGTGGTTTATGCAGCGAGGCCGGGGTTACGTCTGTGGAGGACAGATGTGCGAGGACGTGTCGGGGAGACTCATGTCTTAAAGCCCCTTTTTAATCAAGATGTACCTCACTTTGAGCTGTTCCCACGCTCAGGTCCCACTGGTGGATACAGACCTTCAGAAAGACAGTTAGGAATGATCAGCTGCTTCCTGAAGGAGGGCTGGGTCCTCAGCTGGAACGAATATAGTGTTTATGTTGTGGACTGCACCAATCAGGTGTGAATGGACACTTTTGGATTTATTTTATTTGCATAATTGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10589
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104224 Nonsense 740 1358 8 19
ENSDART00000133668 Nonsense 690 1308 8 19
ENSDART00000133971 Nonsense 360 978 2 13
Genomic Location (Zv9):
Chromosome 17 (position 29365327)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29289254
GRCz11 17 29306217
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTGAGCTTGCAGAGCTCATCTGCTGAGCAGAAGGAGGATGAAGAGACA[C/T]AGCTCCTCAAAGCTGACCAGGTCAGAGAGCATATCCRATTARGAGACCTA
Long Flanking Sequence:
CCATTCAGAGCCCATCAGAGCCCTTGCTGAACCAAGAGCCATGTCTGGTTGCAGTTAACCAAGCAGCACAGACCTCACCACCTTGCCCCGCGTCTCTGACACTAGACATGGAGTGTCAGTTGTACAGTGAAAATGTGTTTGCTGAAAATGAGCAAATCGCAGCTACACCTGATGTAGACATGCTGCTGGAATGTACCTTCTCGTACATGCAGGCATCTGACGAGCAGGACATCATGAAGAAATATGTGAAGGAGCACAAAGACGTCCTGGAGGATTCAGAGGAACATTTTAAGCAGAGTTTACATGAGGACTTTAATTTGGACTTGTCTTATGATCCCATTAGGCCGCTGGGTTACTCCCCTGAGCCTGAGCCATCGCCATCTAGTGACGAGGAGGACATCTATGCTCATGGAGTTCCATCCAGTGCAAGTCTTGGGGATGGACTGAATGCTCTGAGCTTGCAGAGCTCATCTGCTGAGCAGAAGGAGGATGAAGAGACA[C/T]AGCTCCTCAAAGCTGACCAGGTCAGAGAGCATATCCAATTAAGAGACCTACTTGGTTACCTTTACAATTTATAAGGCTGTGTAATATACACTACTGTTAAAAGAGTTTTAAAAGAGATTTCATATGTATCATGAAAATGAGGGTAAAAACAATAACAGTATAATGATGGAGCTAAATTTTCTACTGAATTACTTCAGGTGCCATATTTAAATGGTGCTACTGTAACCTTTTTAAATATTTATTTTTAGTCCTTTTGCTTTTATTATGACAGGACCAGTAGCTAGATCGGAAATGAAGATGAAGACAGACTAAGGGGCTGCGATTGGAAAAGGCCTGAAATGCATTGCCAGTATATGTCAGTAGGGTTTGGCTGCGGACTGCAAGACGGGCGTAGCATGAAGGGGCCTTAGGGGCTTGTAGTATGTTAGAGGTGTAGGAGCATGTCAAAACTATGTTGTCAGCAAGATGGTGCTGTACATCAGTTATTAACGGCTACACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15119
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104224 Nonsense 1216 1358 17 19
ENSDART00000133668 Nonsense 1166 1308 17 19
ENSDART00000133971 Nonsense 836 978 11 13
Genomic Location (Zv9):
Chromosome 17 (position 29347245)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29271172
GRCz11 17 29288135
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGTGYTTTTCTTTTYCTGATGTTTWCTTTGAGCAGCCTGCWGGACAYTA[T/A]TTGGTGAAGAYTCAGACCAGTCCTAATGACCGCATGCTGTGGGCACTGGA
Long Flanking Sequence:
TTATTAGCAATTATGTATAATAAAATCAGTTTAAAATGTATATATTTAATTTTATACATTCATTCATTTTCTTTTCGGCTTAGTCGCCTTATTTGGACCTTACTGTAGCACAAACTAAAGTCATATTTAATGTGTACTTAGTATCAACCCTTGTGGAAAAAAAAATCCTCAAAAAGTATTTGTTTTATATAATTTCTAAACCAGATACACTGTTTACAAGAGACTTGGCAAATCCGATTCCACACTGAAATTCTGTTTAAAGCTACATTCCTACTGAAATTGAAAAAGATAAAAGTTTTGAAATGATATTCACTCATTAAGCAAATTTGGAACAAAAAAGTTTACATACTGCAACTTTAAATGTAATATTTTTAATACACAGGTCCTACAATGATCCAGTTCAGGATCATTTATGCCATTAAACACACCATATAATAGTTCACCTACCTGATGTGCTTTTCTTTTCCTGATGTTTTCTTTGAGCAGCCTGCTGGACATTA[T/A]TTGGTGAAGATTCAGACCAGTCCTAATGACCGCATGCTGTGGGCACTGGACAACAGAGGCAATGTGCTCGTACGTATCGGCATCACTGAGGAGATGCCTGTTGGGACGGCCTGGGAGCACATTCCAGGTAAGCCACCATTACATAATCCTATTCGCTGTTGTCATTTTTATTTTTTTTATTTTTTAAATAAAACTGTTAAATTTAAGTTCTTTTTTATAAGTGACTTTCTGATTGGTCATTGTTTTTTTGTTTTTTTTTTCCTGTAGGACTTCAGGCATGTCAGTTGGTTCTGAGCATGAGGACCGCTTGGGTTCGTCTTGCTAATGGGCAAGTGGCTCGTCGATACGGAATTACAGAGAAAAACCCTGCTGGAGATTACTGGAAGAAGATCCCTGGACTGGCCAGCTGCCTCGCAGGTGAGCTTTTAGGATCAATTAAGGCAAACATTAGTGTCAAAAAATAATTATAAGAATTTCTTGCTCCTCCATATTTTTTAGAT
Associated Phenotype:
Not determined