Busch Lab

ZMP

si:dkey-254a11.3

Ensembl ID:
ENSDARG00000060783
ZFIN ID:
ZDB-GENE-050208-640
Description:
hypothetical protein LOC100124613 [Source:RefSeq peptide;Acc:NP_001096109]
Human Orthologue:
ACAP2
Human Description:
ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 [Source:HGNC Symbol;Acc:16469]
Mouse Orthologue:
Acap2
Mouse Description:
ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 Gene [Source:MGI Symbol;Acc:MGI:1925868]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa18252 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4196
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085931 Essential Splice Site 95 802 4 24
ENSDART00000124742 Essential Splice Site 95 513 4 17
ENSDART00000143190 None None 186 None 5
Genomic Location (Zv9):
Chromosome 22 (position 40760914)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 37840829
GRCz11 22 37775837
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGAGCACGTTTGCAGAGAATCTTCAAGAGATGATCAACTATCACACAG[T/A]AAGGAAATCTGGGCTGAAAGTGTTCGTTACTGTGAATAATGACTTCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18252
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085931 Essential Splice Site 286 802 10 24
ENSDART00000124742 Essential Splice Site 286 513 10 17
ENSDART00000143190 None None 186 None 5
Genomic Location (Zv9):
Chromosome 22 (position 40736704)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 37816619
GRCz11 22 37751627
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGGAWATCTGTTCAAGAGGRCCAGCAACGCCTTCAAAACCTGGAACAGG[T/G]CAGTCACTGAAYATCTNNNNNNGCAGCGACACAAACACAGTCAAACYAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29840
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085931 Nonsense 299 802 11 24
ENSDART00000124742 Nonsense 299 513 11 17
ENSDART00000143190 None None 186 None 5
Genomic Location (Zv9):
Chromosome 22 (position 40736336)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 37816251
GRCz11 22 37751259
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTCCTTCGCAGGCGGTGGTTTTCCATTCAGAACAATCAGCTGGTGTAC[C/T]AAAAGAAGTTTAAGGTAAAAGAGAAATCAAATAAAACAACAATCAACGTT
Associated Phenotype:
Not determined