Busch Lab

ZMP

si:dkey-231l1.6

Ensembl ID:
ENSDARG00000060768
ZFIN ID:
ZDB-GENE-060503-156
Description:
Ankyrin repeat and IBR domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q1L8G6]
Human Orthologue:
ANKIB1
Human Description:
ankyrin repeat and IBR domain containing 1 [Source:HGNC Symbol;Acc:22215]
Mouse Orthologue:
Ankib1
Mouse Description:
ankyrin repeat and IBR domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1918047]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa5929 Nonsense Mutation detected in F1 DNA Not yet available
sa36917 Nonsense Available for shipment Available now
sa23595 Nonsense Available for shipment Available now
sa23596 Essential Splice Site Available for shipment Available now
sa6124 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17107 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
hu7874
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085980 Essential Splice Site 363 1053 6 20
ENSDART00000133628 Essential Splice Site 363 1060 7 20
Genomic Location (Zv9):
Chromosome 19 (position 45440780)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44339002
GRCz11 19 43934575
KASP Assay ID:
554-2382.1 (used for ordering genotyping assays)
KASP Sequence:
CACCCATATGATCTATTCTAAACAAATAAACGTATATATTCCAATCGCTT[A/G]CCCTTCCCAGCATGCCCGGCAGAACTCGTGTMCACATGACATGTCCACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5929
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085980 Nonsense 436 1053 8 20
ENSDART00000133628 Nonsense 436 1060 9 20
Genomic Location (Zv9):
Chromosome 19 (position 45444431)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44342653
GRCz11 19 43938226
KASP Assay ID:
554-3931.1 (used for ordering genotyping assays)
KASP Sequence:
CAATCCACTGGTGCCCTGTAGCCAGATGTGAAAGAGCCGTTCGTCTGACT[C/T]GACCAGGCCCTGGAGCTTCTGACCCGCTGAGCTTCCCGTTGCTGAAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36917
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085980 Nonsense 477 1053 9 20
ENSDART00000133628 Nonsense 477 1060 10 20
Genomic Location (Zv9):
Chromosome 19 (position 45448806)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44347028
GRCz11 19 43942601
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCCTGTCTCTCAGGGAGTGTCTTGGGGATGCTCATGAACCCTGTGACTG[T/A]GAAACATGGAAGATGTGGCTGCAGAAAGTGTCTGAGATGAAGCCTGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23595
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085980 Nonsense 500 1053 10 20
ENSDART00000133628 Nonsense 500 1060 11 20
Genomic Location (Zv9):
Chromosome 19 (position 45449425)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44347647
GRCz11 19 43943220
KASP Assay ID:
2261-3699.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGATCATAAGACTTCATCTGCATCTCTCTGAACAGTGGCTGGTGTGAGC[G/T]AAGCTTATGAAGATGCTGCCAACTGCCTGTGGTTACTCTCCAACTCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23596
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085980 Essential Splice Site 743 1053 16 20
ENSDART00000133628 Essential Splice Site 743 1060 17 20
Genomic Location (Zv9):
Chromosome 19 (position 45458121)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44356343
GRCz11 19 43951916
KASP Assay ID:
2261-3700.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTATTTCTAAAGATCATCTGTGTTATCATAATTTTCCCCTCTTTTTCA[G/A]TTTTGCTGGCGGGACGTGGGACTGGGAGTATCTGGGATTTGCTTCTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6124
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085980 None None 1053 None 20
ENSDART00000133628 Essential Splice Site 824 1060 18 20
Genomic Location (Zv9):
Chromosome 19 (position 45461351)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44359573
GRCz11 19 43955146
KASP Assay ID:
554-3823.1 (used for ordering genotyping assays)
KASP Sequence:
AACACATGAACGAGCCACTGAACGACACTCATACTCACTCTGAAATATGT[G/A]TGTGTTTGTGTTTATAGAAACACATGAGGGAGGCACTTCACAACGGCATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7889
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085980 Nonsense 1025 1053 20 20
ENSDART00000133628 Nonsense 1009 1060 19 20
Genomic Location (Zv9):
Chromosome 19 (position 45466208)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44364430
GRCz11 19 43960003
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAAAGAGGGGGAGGTTTCGGAGTGTGTTGAAGATGCTAAAACGGAGGCTT[C/A]AGATCTCACKGTTTGTCCTGAAAGCAGCGCCGATCCGCAGGTAAACAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17107
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085980 None None 1053 None 20
ENSDART00000133628 Nonsense 1050 1060 20 20
Genomic Location (Zv9):
Chromosome 19 (position 45466618)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44364840
GRCz11 19 43960413
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACATAAAATCAGTTCTGGTGGCCTTAGACGAAATGTGTTTTCTTTGGGT[C/T]GAAGATGGAAGGGGTTTTCATGCAKTACAAAATAAGGGCGYAATACAGCT
Associated Phenotype:
Not determined