Busch Lab

ZMP

si:ch1073-179p4.1

Ensembl ID:
ENSDARG00000060751
ZFIN ID:
ZDB-GENE-100921-50
Human Orthologue:
TAOK3
Human Description:
TAO kinase 3 [Source:HGNC Symbol;Acc:18133]
Mouse Orthologue:
Taok3
Mouse Description:
TAO kinase 3 Gene [Source:MGI Symbol;Acc:MGI:3041177]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa20366 Nonsense Available for shipment Available now
sa2237 Essential Splice Site Available for shipment Available now
sa20365 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20366
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085943 Nonsense 428 903 12 19
ENSDART00000140668 Nonsense 421 896 13 20
Genomic Location (Zv9):
Chromosome 5 (position 17158562)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14887216
GRCz11 5 15387433
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATTCCTCATCGGGACCACCGGTCGGACCTTCGACCGTCCTCGTCTGAG[C/T]GAGCTCAAGCTCACAACTATAAAAACCGTGAGCGCTTCGCCACCATCAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26423
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085943 Nonsense 700 903 16 19
ENSDART00000140668 Nonsense 693 896 17 20
Genomic Location (Zv9):
Chromosome 5 (position 17140872)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14869526
GRCz11 5 15369743
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCACCAAACAGAACTGGAGAACCAAATCGAATACAACAACCGAAGAGAA[C/T]GAGAACTGCACAGGAAACATGTGCTCGAACTTCGGCAGCAGCCCAAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2237
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085943 Essential Splice Site 718 903 16 19
ENSDART00000140668 Essential Splice Site 711 896 17 20
Genomic Location (Zv9):
Chromosome 5 (position 17140815)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14869469
GRCz11 5 15369686
KASP Assay ID:
554-3028.1 (used for ordering genotyping assays)
KASP Sequence:
TGCACAGGAAACATGTGCTCGAACTTCGGCAGCAGCCCAAGAACCTCAAG[G/A]TACTACCAGTTGTRGAGAAGCRTTTATTACTTTGCTTTATATAGTGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20365
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085943 Essential Splice Site 850 903 18 19
ENSDART00000140668 Essential Splice Site 843 896 19 20
Genomic Location (Zv9):
Chromosome 5 (position 17135201)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14863855
GRCz11 5 15364072
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAGCTGGAGCAGAAAGTCTCTCTGCGCAGAGCACACCTGGAACAGAAG[G/A]TCTAGTCCTGCTATTCACCTCTTCTTCACATAGAATCCACTCAAATATAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26422
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085943 Nonsense 867 903 19 19
ENSDART00000140668 Nonsense 860 896 20 20
Genomic Location (Zv9):
Chromosome 5 (position 17132556)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14861210
GRCz11 5 15361427
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATCGAGGAGGAGCTGGCTTCTCTTCAGAAAGAGCGAACCGACCGAATC[A/T]AACATCTGCTGGACCGTCAGGAGAGAGAAATCGACGCCTTCGACATGGAG
Associated Phenotype:
Not determined