Busch Lab

ZMP

appl1

Ensembl ID:
ENSDARG00000060734
ZFIN ID:
ZDB-GENE-081016-1
Description:
adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 [Source:Ref
Human Orthologue:
APPL1
Human Description:
adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 [Source:HGNC
Mouse Orthologue:
Appl1
Mouse Description:
adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 Gene [Source

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
hu3559 Nonsense Confirmed mutation in F2 line Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27831
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085868 Essential Splice Site 19 706 2 23
Genomic Location (Zv9):
Chromosome 11 (position 43683242)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42313378
GRCz11 11 42603940
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGTTTGAATGACGTTATTGACAGTGTAATAATCATGAGTGTGTTTGTA[G/T]ACTCGTTCTCTGCTGGGTGTGTTTGAAGAAGATGCAGCAGCGATTTCCAG
Long Flanking Sequence:
AAAAATAGTACACACAGTAAATAGTAGTAAAAAAAAAAGAAGTGATATTTATATATAATAATTCAATACAATTTTAACAATACATCATAGTATTCAGTATATCACATTAATATTCAATATATTATGTTATTATTCAACATATTATTCATACATGTAGTGATGACATTAAACTAGTAAACTAGATACTGGATACTAGTTTTCAGCTTAAAGTGACATTTAAAGGCTTAATCGAAAAGAAAAAAAATTCTTAATAATATTGACTTTAAAAATTGGTTAAAAAAACAGCTTTATTCTAGCCAAACTAAAAGGAAGAAGACTTTCTCCACAAGAAAAAATATTATAGGAAATACTGTAAAAATTTCCTTGCTCTGTTAAACATAATTTGGAAAATATTCACATTAAAATGCACAAAATATTAATAAAATGCACAGACATTAACTGTATGTTAATGATGTTTGAATGACGTTATTGACAGTGTAATAATCATGAGTGTGTTTGTA[G/T]ACTCGTTCTCTGCTGGGTGTGTTTGAAGAAGATGCAGCAGCGATTTCCAGTTATTTCAATCAGCTTTTCAAAGCCATGCAGAGGATCTACGACGCCCAGGTGAGAATTCAGCCTTAATTCCAGATTAAATCAATGATTATTACATAAACTCCCTGAATTTATATAATCTGAGAGAACATTATAAAAGAGTCTGATAAATTTAAACTGTAAATTTTGTCTTAATTCACATTAAAATTAAAATATTGAAATTACAGCTCGTGTTTTAGATAAAGAAATTAAAACTACTTTTTAAGATCAGGATTTTAAAGAAATATTATTATTATTTGTATTATAACTTATAATTTTAAAATATAGCAATTAATACAATTATGTATTATTATCCCTCTTTAATGGCTTATACAGTATATTATTTAGTATTTGTATTTTATATTAAAATAAAACAAAAAATGTTCAGTCATATTTTCAATAAAAAATTAAGTCAAGTTTTTTAAATGTTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3559
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085868 Nonsense 88 706 4 23
Genomic Location (Zv9):
Chromosome 11 (position 43684803)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42314939
GRCz11 11 42605501
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGTTTTCCTTTAGGTGGCGACGACGAGGTGATGAGCTCCACTTTGCAG[C/T]AGTTTGCTAAAGTTATCGACGAGGTGAGAAACTCCTCCATCGCTCATGAA
Long Flanking Sequence:
ATTGTAAAGCTTATTTTAGATTAAGAAAATTAAAATGTTTTTAAAAGTAATTTTTATTATTATTCATATTATTATTATTCATATTATTAATATTATTATTATCATCATTATTTAAGGTATAACAGTTACTGCAGTTATATCTTATATATTATTTATGCCATTAATAAATTGATATAATCATTGTTATGAAACAAAAAAATCAGGTATTTATTAATTAACAAATTAATTAATTAATGCAATGAAAATGTAATTGTAATGAAACAGTTGTAAAAAGGTTTTCCTGAGCCTGATGTGTTTCTCTTTGCAGAATGAACTGAGCGCTGCCACACATCTGACATCGAAACTACTGAAAGACTACGAGAAGCAGGTGATTTTCAGCTCATTTTCAGTCATGTTTTGTGTTTCTGTCTCTGAATGTCTGAAAACTGTCTGTGGTTGTGTCTGCTGTTCAGCGTTTTCCTTTAGGTGGCGACGACGAGGTGATGAGCTCCACTTTGCAG[C/T]AGTTTGCTAAAGTTATCGACGAGGTGAGAAACTCCTCCATCGCTCATGAACGACCGTATTAATATTAATAACAGTTCTGGTTATAACTGTGTTTTTATTTCAGCTCAGCTCCTGTCACGCGGTTCTCTCCACGCAACTCGCAGATGCCATGATGTTCCCCATCACACAGTTTCAGGAGAGAGACCTGAGAGGTGCATTATAGAGGATTCTCACTACCTTACTGTAATTTATTTGGTTAATAAATAATGCATAATTGATTGTTATACAAAGAAGGAAATTACCTGCATTTTTATGTTAATTTGTTTAAAACAAATTTTTAAGTTATTTGTTTTTTTGCACATTACTGTTTTATATATTTTTATATATTTTTATTTATTTAATTATCATTAATATTAATACATTTAATTAATATGTTAAAATTAATACATTATTACAAACATTAATGCAAAAAAATTGTTTTATTGTACAAAATGCTTGAAAAATACATTTATGTGCCTATA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461