Busch Lab

ZMP

Q1RLS4_DANRE

Ensembl ID:
ENSDARG00000060725
Description:
LOC556590 protein [Source:UniProtKB/TrEMBL;Acc:Q1RLS4]
Human Orthologue:
DNAJC16
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 16 [Source:HGNC Symbol;Acc:29157]
Mouse Orthologue:
Dnajc16
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 16 Gene [Source:MGI Symbol;Acc:MGI:2442146]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa41763 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35008 Nonsense Mutation detected in F1 DNA Not yet available
sa13518 Nonsense Available for shipment Available now
sa5836 Nonsense Mutation detected in F1 DNA Not yet available
sa10882 Essential Splice Site Available for shipment Available now
sa16709 Essential Splice Site Available for shipment Available now
sa35007 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41763
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085855 Essential Splice Site 63 789 1 14
Genomic Location (Zv9):
Chromosome 11 (position 3671484)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3589988
GRCz11 11 3609375
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGCCTCACTGAAATCAAGAAAATGTACAAGAAACTGGCAAGAGAATGG[T/G]GAGTAATAAGGCTGAAATCTACCTGTTTTTGAGCCTGTCATTCAGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35008
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085855 Nonsense 136 789 3 14
Genomic Location (Zv9):
Chromosome 11 (position 3669158)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3587662
GRCz11 11 3607049
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGACAGTTTCTACTTCGACGAATCGTTCTTTCACTTCCCTCGGACGAGT[C/T]GAGACTTCACCGAGAGCAAACATCTCCTACACTACAACCAGTACATGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13518
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085855 Nonsense 239 789 4 14
Genomic Location (Zv9):
Chromosome 11 (position 3668606)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3587110
GRCz11 11 3606497
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTCAATGGAAAAGTCAYTTTCTTCCACTACTCTGTGGTCAGAGAACACT[T/A]GAGGCAGTTTGTGGAAAGCCTTCTGCCCCAGAGACTAGTAGAGAAGGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5836
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085855 Nonsense 480 789 9 14
Genomic Location (Zv9):
Chromosome 11 (position 3662883)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3581387
GRCz11 11 3600774
KASP Assay ID:
554-3799.1 (used for ordering genotyping assays)
KASP Sequence:
TGACGGGCGGATGGAACGGCAGTGATGATGATAAGCATCGCCTCCATGAG[C/T]AGCTTGAGCTTCTGCAAAGAGACCCCTCCTACCTTACCCATGATGCCATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27714
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085855 Nonsense 499 789 9 14
Genomic Location (Zv9):
Chromosome 11 (position 3662826)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3581330
GRCz11 11 3600717
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTTCTGCAAAGAGACCCCTCCTACCTTACCCATGATGCCATGCTGCCT[G/T]AACTTAACAATGAGTTTGCTTCTGTGAGTCTTATAGAGGATACAAGGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10882
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085855 Essential Splice Site 559 789 11 14
Genomic Location (Zv9):
Chromosome 11 (position 3660879)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3579383
GRCz11 11 3598770
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTCGGCTCTTTTCATCCTGTTCGGGACTGTAATCATTCAGGCCTTCAG[G/A]TTGGASTCACAATTTGGTTAGATTTTTTNCCCAAGCACATTTTTRAGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16709
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085855 Essential Splice Site 559 789 12 14
Genomic Location (Zv9):
Chromosome 11 (position 3660794)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3579298
GRCz11 11 3598685
KASP Assay ID:
2260-3846.1 (used for ordering genotyping assays)
KASP Sequence:
CACATTTTTRAGTCCAGTTGTGCATTTACTTGTATTTGTTATGCTGAACA[G/A]TGACKCTGGGGAGGAAAAACCAACCAAACAAAAGGCCACAGAGTCACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35007
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085855 Nonsense 779 789 14 14
Genomic Location (Zv9):
Chromosome 11 (position 3657420)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3575924
GRCz11 11 3595311
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGAGCGGCTCATGGAGGGAACTCTACCAAGGCACTACGTTTCAGCCTG[G/A]CCCGGTATGGACACCATCACACCGCAGAAATAAGACTATACCCATAGCAG
Associated Phenotype:
Not determined