Busch Lab

ZMP

si:dkeyp-84g1.1

Ensembl ID:
ENSDARG00000060707
ZFIN ID:
ZDB-GENE-050419-121
Description:
peroxisomal membrane protein 11A [Source:RefSeq peptide;Acc:NP_001096590]
Human Orthologue:
PEX11A
Human Description:
peroxisomal biogenesis factor 11 alpha [Source:HGNC Symbol;Acc:8852]
Mouse Orthologue:
Pex11a
Mouse Description:
peroxisomal biogenesis factor 11 alpha Gene [Source:MGI Symbol;Acc:MGI:1338788]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa23309 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23309
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085824 Nonsense 216 246 3 3
Genomic Location (Zv9):
Chromosome 18 (position 25334560)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 25564333
GRCz11 18 25550865
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAAAAATGTTTGTGACCTTTTCATTCCACTTGACAAACTGGGTATTTAC[C/T]AGACAAATGCAGGGGTGGTGGGCTTCTGTGGGCTTGTGTCCTCGCTTTTA
Associated Phenotype:
Not determined