Busch Lab

ZMP

npffr2.2

Ensembl ID:
ENSDARG00000060702
ZFIN ID:
ZDB-GENE-070705-159
Description:
Novel protein similar to human and mouse neuropeptide FF receptor 2 (NPFFR2) [Source:UniProtKB/TrEMB
Human Orthologue:
NPFFR2
Human Description:
neuropeptide FF receptor 2 [Source:HGNC Symbol;Acc:4525]
Mouse Orthologue:
Npffr2
Mouse Description:
neuropeptide FF receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1860130]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa478 Nonsense Confirmed mutation in F2 line Not yet available
sa26511 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa5304 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa478
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085821 Nonsense 118 438 2 6
ENSDART00000135063 Nonsense 89 336 2 3
Genomic Location (Zv9):
Chromosome 5 (position 34717352)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32499301
GRCz11 5 33099454
KASP Assay ID:
554-0210.1 (used for ordering genotyping assays)
KASP Sequence:
TAATTTTTCATGTTTCTCCTGCAGGCTGGCCTTTTGGCAGTTTGGTGTGT[A/T]AGCTGAGTGGGATGGTGCAAGGAATATCAGTATCCGCATCAGTATTTACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3525
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085821 Nonsense 205 438 3 6
ENSDART00000135063 Nonsense 176 336 3 3
ENSDART00000085821 Nonsense 205 438 3 6
ENSDART00000135063 Nonsense 176 336 3 3
Genomic Location (Zv9):
Chromosome 5 (position 34721463)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32503412
GRCz11 5 33103565
KASP Assay ID:
2259-6092.1 (used for ordering genotyping assays)
KASP Sequence:
GTCTCCATCCTGCTAAGCGATGGCAACACTACGCAGCCCTTCTACTGGTG[T/A]CGTGAAAACTGGCCCAACCAAGAGATGCGCAAGATCTACACCACGGTACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18805
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085821 Nonsense 205 438 3 6
ENSDART00000135063 Nonsense 176 336 3 3
ENSDART00000085821 Nonsense 205 438 3 6
ENSDART00000135063 Nonsense 176 336 3 3
Genomic Location (Zv9):
Chromosome 5 (position 34721463)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32503412
GRCz11 5 33103565
KASP Assay ID:
2259-6092.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTCCATCCTGCTAAGCGATGGCAACACTACGCAGCCCTTCTACTGGTG[T/A]CGTGAAAACTGGCCCAACCAAGAGATGCGCAAGATCTACACCACGGTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26511
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085821 Essential Splice Site 423 438 3 6
ENSDART00000135063 None None 336 None 3
Genomic Location (Zv9):
Chromosome 5 (position 34722117)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32504066
GRCz11 5 33104219
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGGACTCATCCAGGGGCTGGTGTCTGTGAGCAATGGGAAGGGTTTGGG[T/G]GAAAGAAGCCAGTCTTCAGGGAAAGAGAACATGAAAGAACAGGATCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5304
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085821 Essential Splice Site 428 438 5 6
ENSDART00000135063 None None 336 None 3
Genomic Location (Zv9):
Chromosome 5 (position 34723130)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32505079
GRCz11 5 33105232
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGAACAAGTTTRGTRATYCCTGCTTTACAGCATGCACATAAAATAATTT[G/A]AATGCCAAACAASATATATACAGCTGAAGTCAGAATGATTAGCCCCCCTG
Associated Phenotype:
Not determined