Busch Lab

ZMP

mll4b

Ensembl ID:
ENSDARG00000060697
ZFIN ID:
ZDB-GENE-080521-1
Description:
Myeloid/lymphoid or mixed-lineage leukemia 4b [Source:UniProtKB/TrEMBL;Acc:A5XBQ6]
Human Orthologue:
AD000671.3
Human Description:
Histone-lysine N-methyltransferase MLL4 [Source:UniProtKB/Swiss-Prot;Acc:Q9UMN6]
Mouse Orthologue:
Wbp7
Mouse Description:
WW domain binding protein 7 Gene [Source:MGI Symbol;Acc:MGI:109565]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa35966 Nonsense Mutation detected in F1 DNA Not yet available
sa22705 Nonsense Available for shipment Available now
sa22704 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35966
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127708 None None 124 None 5
ENSDART00000128947 Nonsense 644 3111 3 35
Genomic Location (Zv9):
Chromosome 15 (position 36221280)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 37621284
GRCz11 15 37522869
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCGGTAGCTCTTGCCAGAGGGTAGAATTACTGCAACAAAAAGACAAAGA[C/T]GAAAACCAAAAGAACGGCCTGTTAAGGCCTGTCCCAACAAGACTGAAGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4623
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127708 None None 124 None 5
ENSDART00000128947 Nonsense 1393 3111 19 35
Genomic Location (Zv9):
Chromosome 15 (position 36183119)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 37583123
GRCz11 15 37484708
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACATCTGGCTAATATGCAGAAGGGTCATTTGATGGACATGAGGGCGTTA[C/T]GAATGARCCTGAAAGGTAAATAAACATACATGCCAAAGCAGTAGGAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22705
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127708 None None 124 None 5
ENSDART00000128947 Nonsense 1723 3111 27 35
Genomic Location (Zv9):
Chromosome 15 (position 36179912)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 37579916
GRCz11 15 37481501
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCAGGAGCTGCTCCATCCAAACCCCACCACATCTTGACTATTAGTGATT[T/A]GGAAGACACTCGAAGGCCTCGACGGCATAGCCCTCACACCCAAAATAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22704
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127708 None None 124 None 5
ENSDART00000128947 Nonsense 2091 3111 27 35
Genomic Location (Zv9):
Chromosome 15 (position 36178809)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 37578813
GRCz11 15 37480398
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATTAATTGTTGTTTTGAGTCAGTTCCCAACTCAGAGGTGCTCACTGAC[C/T]AAGATTCCTTTGGGCTTACTCAAATTTTGGAATCCAGCTCTGGGGTTTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6394
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127708 None None 124 None 5
ENSDART00000128947 Nonsense 2111 3111 27 35
Genomic Location (Zv9):
Chromosome 15 (position 36178749)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 37578753
GRCz11 15 37480338
KASP Assay ID:
554-5148.1 (used for ordering genotyping assays)
KASP Sequence:
TTGGGCTTACTCAAATTTTGGAATCCAGCTCTGGGGTTTGTGGTCMCCAA[C/T]AAGACACCTTGATTARTTTTGTTGAGTCAAAGTCTTCAAATCCTACATTT
Associated Phenotype:
Not determined