Busch Lab

ZMP

si:dkey-79p17.2

Ensembl ID:
ENSDARG00000060671
ZFIN ID:
ZDB-GENE-081104-434
Description:
Novel protein similar to vertebrate lactase (LCT) [Source:UniProtKB/TrEMBL;Acc:B0UYB8]
Human Orthologue:
LCT
Human Description:
lactase [Source:HGNC Symbol;Acc:6530]
Mouse Orthologue:
Lct
Mouse Description:
lactase Gene [Source:MGI Symbol;Acc:MGI:104576]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa2489 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa2489
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085738 Nonsense 1109 1900 8 17
ENSDART00000144512 Nonsense 802 1593 3 12
Genomic Location (Zv9):
Chromosome 9 (position 47576430)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 46575233
GRCz11 9 46375712
KASP Assay ID:
554-2761.1 (used for ordering genotyping assays)
KASP Sequence:
GGGCAGAACCCCTGGATGTCAACATCCCTCGAGAGGTTGTGGCTGCAGAC[C/T]GAGCCCTTCAGTTCCAACTAGGTTGGTYTGCACAYCCCATATTTAAAAAT
Long Flanking Sequence:
CATTGTCATGGTCTCGGATCTTTCCAAATGGCTATAAATCTTCCCTTAACCAGAAGGGGGTGGATTACTACAACAGGCTCATAGATGGTCTCATAGCAAATAATATCACACCCATGGTGACTCTCTACCATTGGGACCTGCCGCAGGCTTTACAGAACATCCATTGGGACAACACTGAAATGATTGGCTTATTCAATGAATATTGTGACTTCTGCTATGCAACATTTGGAGATAGGGTGAAGTTTTGGATCACCTTTAATGAACCCCAGACGATTGCATGGTTGGGATATGGGCTGGGTCAGATTCCACCTAACGTGAAGCAACCAGGAGATGCTCCATACAGGGTTGCACACAACCTCCTGAAAGCTCATGCACAAGCTTATCACACATATGATGAGAAATACAGGGCATCTCAAGGTGGTCTGGTATCCATTAGTCTGAATGCTGAATGGGCAGAACCCCTGGATGTCAACATCCCTCGAGAGGTTGTGGCTGCAGAC[C/T]GAGCCCTTCAGTTCCAACTAGGTTGGTTTGCACACCCCATATTTAAAAATGGTGACTACCCTGAAGCCATGAAGTGGCAAGTTGGCAACAAGAGTGAACTGCAAGGCTTGAAGGAATCCCGCTTACCTCATTTTACTGACCAAGAAAAAGCCTTTATCCAAGGAACAGCTGATGTATTCTGCATTAACACATACACTACCAAAGTCGTGCGCCATGTGACCAGCAGACTTAATATCGAATCCTATCAGACTGACCAGGATATTGAGAAGGACAAGGCAGATGGCTCTGAAAATACAGCTGTTAGTGAGCAGAAAGCTGTTGCTTGGGGACTCAGGAGACTTCTCATTTGGTTGAAAGAAGAGTATGGAAATCCTGAGATTTATATTACGGAAAATGGTGTAGCTACAGGCACTGCCATTACGACAGATGACACTGATAGAATATTCTACTTGAAGACCTATGTTGATGAGGCTCTTAAAGGTATAGTTGCATTGTTCATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5570
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085738 Nonsense 1134 1900 8 17
ENSDART00000144512 Nonsense 827 1593 3 12
Genomic Location (Zv9):
Chromosome 9 (position 47576353)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 46575156
GRCz11 9 46375635
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TYTGCACAYCCCATATTTAAAAATGGTGACTACCCTGAAGCCATGAAGTG[G/A]CAAGTTGGCAACAAGAGTGAACTGCAAGGCTTGAAGGAATCCCGCTTACC
Long Flanking Sequence:
CTCATAGATGGTCTCATAGCAAATAATATCACACCCATGGTGACTCTCTACCATTGGGACCTGCCGCAGGCTTTACAGAACATCCATTGGGACAACACTGAAATGATTGGCTTATTCAATGAATATTGTGACTTCTGCTATGCAACATTTGGAGATAGGGTGAAGTTTTGGATCACCTTTAATGAACCCCAGACGATTGCATGGTTGGGATATGGGCTGGGTCAGATTCCACCTAACGTGAAGCAACCAGGAGATGCTCCATACAGGGTTGCACACAACCTCCTGAAAGCTCATGCACAAGCTTATCACACATATGATGAGAAATACAGGGCATCTCAAGGTGGTCTGGTATCCATTAGTCTGAATGCTGAATGGGCAGAACCCCTGGATGTCAACATCCCTCGAGAGGTTGTGGCTGCAGACCGAGCCCTTCAGTTCCAACTAGGTTGGTTTGCACACCCCATATTTAAAAATGGTGACTACCCTGAAGCCATGAAGTG[G/A]CAAGTTGGCAACAAGAGTGAACTGCAAGGCTTGAAGGAATCCCGCTTACCTCATTTTACTGACCAAGAAAAAGCCTTTATCCAAGGAACAGCTGATGTATTCTGCATTAACACATACACTACCAAAGTCGTGCGCCATGTGACCAGCAGACTTAATATCGAATCCTATCAGACTGACCAGGATATTGAGAAGGACAAGGCAGATGGCTCTGAAAATACAGCTGTTAGTGAGCAGAAAGCTGTTGCTTGGGGACTCAGGAGACTTCTCATTTGGTTGAAAGAAGAGTATGGAAATCCTGAGATTTATATTACGGAAAATGGTGTAGCTACAGGCACTGCCATTACGACAGATGACACTGATAGAATATTCTACTTGAAGACCTATGTTGATGAGGCTCTTAAAGGTATAGTTGCATTGTTCATGTAAACCAATCATAAACATACATTTTTGAGATTTGTACACAACTGCCAAATATTTACCCCTGCAACATAAGACTGGTT
Associated Phenotype:
Not determined