Busch Lab

ZMP

si:ch211-208m1.2

Ensembl ID:
ENSDARG00000060661
ZFIN IDs:
ZDB-GENE-030131-7240, ZDB-GENE-070424-152
Description:
Krueppel-like factor 8 [Source:RefSeq peptide;Acc:NP_001073472]
Human Orthologue:
KLF8
Human Description:
Kruppel-like factor 8 [Source:HGNC Symbol;Acc:6351]
Mouse Orthologue:
Klf8
Mouse Description:
Kruppel-like factor 8 Gene [Source:MGI Symbol;Acc:MGI:2442430]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa24008 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24008
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085728 Essential Splice Site 9 343 1 6
ENSDART00000142106 None None 182 None 3
ENSDART00000147219 None None 220 None 3
Genomic Location (Zv9):
Chromosome 21 (position 36996867)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37985905
GRCz11 21 38033611
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCACCGCCGCTTAGATACCGAGATGCACACGGAGACTCGGAACAAAAAA[G/A]TAAGTCTGTTTATCGTTTGCAATCGACACATTTGCAGCATAGCTTTGGCC
Associated Phenotype:
Not determined